AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i129_Transmembrane_Transport_3_pyro_reg_100.orf -o129_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00900 127 Pyrococcus_OT3 Motif number 1 TGTTTTTTCTAAGCTTTTTAAAGGTATCACC 1 50 1 AAGTTTTTAA 0.996281 -78 CGGATAAGTGAAGTTACTTAACAGAATGTTT 1 80 1 AAGTACTTAA 0.988903 -48 TACTTAACAGAATGTTTTTAAGTTAACAATC 1 94 1 AATTTTTTAA 0.985386 -34 ACTAATCCTCAAGATTGTTAACTTAAAAACA 1 106 0 AAGTTGTTAA 0.995579 -22 *** ******* Masking position 5 Map Score: 5.63339 Number of sites scoring better than the average of aligned sites = 70 Number in coding regions = 50 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 2 AGTTATCCCTAGAGCTCTCTTCG 1 4 1 TATCCCTAGA 0.822266 -124 TTCGCTTCCATCTCGCGTGATGTTTTTTCT 1 30 1 TCTCGCGTGA 0.517935 -98 TAACTTCACTTATCCGGTGATACCTTTAAA 1 66 0 TATCCGGTGA 0.698193 -62 ********** Masking position 10 Map Score: 1.59773 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 41 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 AAGAGAGCTCTAGGGATAACT 1 1 0 TGGGATAACT 0.988784 -127 TAAAGGTATCACCGGATAAGTGAAGTTACTT 1 68 1 ACGGATAAGT 0.994191 -60 CTTAAAAACATTCTGTTAAGTAACTTCACTT 1 85 0 TCTGTTAAGT 0.977435 -43 TTAACAATCTTGAGGATTAGTG 1 116 1 TAGGATTAGT 0.984401 -12 * ********* Masking position 7 Map Score: 1.03444 Number of sites scoring better than the average of aligned sites = 102 Number in coding regions = 96 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 4 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0