AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i129_Transmembrane_Transport_3_pyro_reg_300.orf -o129_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00900 127 Pyrococcus_OT3 Motif number 1 TGTTTTTTCTAAGCTTTTTAAAGGTATCACC 1 50 1 AAGTTTTTAA 0.996033 -78 CGGATAAGTGAAGTTACTTAACAGAATGTTT 1 80 1 AAGTACTTAA 0.988167 -48 TACTTAACAGAATGTTTTTAAGTTAACAATC 1 94 1 AATTTTTTAA 0.984421 -34 ACTAATCCTCAAGATTGTTAACTTAAAAACA 1 106 0 AAGTTGTTAA 0.995283 -22 *** ******* Masking position 5 Map Score: 5.63339 Number of sites scoring better than the average of aligned sites = 70 Number in coding regions = 50 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 2 CGAAGAGAGCTCTAGGGATAACT 1 4 0 TCTAGGGATA 0.815281 -124 AGAAAAAACATCACGCGAGATGGAAGCGAA 1 30 0 TCACGCGAGA 0.516835 -98 TTTAAAGGTATCACCGGATAAGTGAAGTTA 1 66 1 TCACCGGATA 0.690447 -62 ********** Masking position 8 Map Score: 1.59773 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 41 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 CCTAGAGCTCTCTTCGCTTCCATCTCGCGT 1 18 1 TCTTCGCTTC 0.986738 -110 TGATGTTTTTTCTAAGCTTTTTAAAGGTAT 1 47 1 TCTAAGCTTT 0.933974 -81 CTGTTAAGTAACTTCACTTATCCGGTGATA 1 74 0 ACTTCACTTA 0.987959 -54 AAGTGAAGTTACTTAACAGAATGTTTTTAA 1 85 1 ACTTAACAGA 0.912235 -43 TCCTCAAGATTGTTAACTTAAAAACATTCT 1 102 0 TGTTAACTTA 0.968692 -26 ********** Masking position 3 Map Score: 1.39429 Number of sites scoring better than the average of aligned sites = 632 Number in coding regions = 570 Number in noncoding regions = 62 Number of orfs with sites within 600 bp upstream = 69 Fraction of orfs with sites within 600 bp upstream = 0.0110826 Motif number 4 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0