AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i135_Transmembrane_Transport_9_pyro_reg_100.orf -o135_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00266 114 Pyrococcus_OT3 Motif number 1 CAGAAATGATATATGAATTGAGGGACAACT 1 18 0 ATATGAATTG 0.978464 -97 ATCAGAAATGACCAGAAATGATATATGAAT 1 30 0 ACCAGAAATG 0.997974 -85 TCTCGAACTGATCAGAAATGACCAGAAATG 1 40 0 ATCAGAAATG 0.996869 -75 AAAATCACCGGAATTGGATATATGAT 1 99 0 ACCGGAATTG 0.99759 -16 ********** Masking position 6 Map Score: 7.75494 Number of sites scoring better than the average of aligned sites = 28 Number in coding regions = 23 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 2 ACCAGAAATGATATATGAATTGAGGGACAA 1 20 0 ATATATGAAT 0.982325 -95 CGAAGCGCTTTTATATGAATGAATCATATA 1 77 1 TTATATGAAT 0.992852 -38 CCGGAATTGGATATATGATTCATTCATATA 1 88 0 ATATATGATT 0.992852 -27 ********** Masking position 5 Map Score: 5.9917 Number of sites scoring better than the average of aligned sites = 8 Number in coding regions = 7 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0