AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i138_Transmembrane_Transport_11_pyro_reg_300.orf -o138_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00338 102 Pyrococcus_OT3 #2 RPH00337 40 Pyrococcus_OT3 #3 RPH00336 19 Pyrococcus_OT3 #4 RPH01519 185 Pyrococcus_OT3 Motif number 1 CTTATTTCCATATATTTAAGACAAAAATCC 1 23 1 TATATTTAAG 0.9654 -80 AGGATCAAGGTATATATAGGATTTTTGTCT 1 41 0 TATATATAGG 0.843135 -62 GCAACCTAGACAAATTTGAGGATCAAGGTA 1 59 0 CAAATTTGAG 0.982326 -44 AATAAAAGAGCAAATTTATGCCTTAAAAAC 2 11 0 CAAATTTATG 0.875257 -30 TGGCATATTTATCCAAATC 3 4 1 CATATTTATC 0.840777 -16 TTAAGTTAAGCAAATATTAGCATGGTGATT 4 15 0 CAAATATTAG 0.808041 -171 GCACAAGGTTTAAATTTAAGTTAAGCAAAT 4 30 0 TAAATTTAAG 0.965553 -156 AAACCTTGTGCATTTTTGGGCAATCCTTTT 4 49 1 CATTTTTGGG 0.938781 -137 AGTTACATAACCTTTTTAAGGAAGTATTAA 4 142 1 CCTTTTTAAG 0.851688 -44 TTAAGGCAACCAAATTTTGGCGAGGGAT 4 168 1 CAAATTTTGG 0.947313 -18 ********** Masking position 5 Map Score: 11.0554 Number of sites scoring better than the average of aligned sites = 448 Number in coding regions = 371 Number in noncoding regions = 77 Number of orfs with sites within 600 bp upstream = 89 Fraction of orfs with sites within 600 bp upstream = 0.0142949 Motif number 2 CTCTTCCACCTCCTTATTTCCA 1 3 1 CTTCCACCTC 0.955685 -100 CTATATATACCTTGATCCTCAAATTTGTCT 1 52 1 CTTGATCCTC 0.964913 -51 GCAAAAATGATTGCAACCTAGACAAATTTG 1 71 0 TTGCAACCTA 0.878882 -32 TTTAAACCCCAATAAAAGAG 2 31 0 TTTAAACCCC 0.963688 -10 TTAACTTAAATTTAAACCTTGTGCATTTTT 4 36 1 TTTAAACCTT 0.964611 -150 TTTAGACGTTTTGAAAACTCACAGAGGATA 4 76 1 TTGAAAACTC 0.928271 -110 AATTGTGGAGTTTTATCCTCTGTGAGTTTT 4 89 0 TTTTATCCTC 0.949826 -97 ATTTGGTTGCCTTAATACTTCCTTAAAAAG 4 153 0 CTTAATACTT 0.792065 -33 ********** Masking position 2 Map Score: 4.26378 Number of sites scoring better than the average of aligned sites = 1184 Number in coding regions = 1057 Number in noncoding regions = 127 Number of orfs with sites within 600 bp upstream = 130 Fraction of orfs with sites within 600 bp upstream = 0.0208802 Motif number 3 ATGATTGCAACCTAGACAAATTTGAGGATC 1 65 0 CCTAGACAAA 0.967719 -38 CCCACCACCCCTGCAAAAATGATTGCAAC 1 84 0 CCTGCAAAAA 0.926759 -19 GTCTAAAAGGATTGCCCAAAAATGCACAAG 4 53 0 ATTGCCCAAA 0.883289 -133 AGAGGATAAAACTCCACAATTTCTTGAATT 4 98 1 ACTCCACAAT 0.975897 -88 GTAACTGAACATTCGACAATAATTCAAGAA 4 118 0 ATTCGACAAT 0.916744 -68 ATCCCTCGCCAAAATTTGGTTGC 4 173 0 CCTCGCCAAA 0.989803 -13 ********** Masking position 3 Map Score: 2.71421 Number of sites scoring better than the average of aligned sites = 343 Number in coding regions = 292 Number in noncoding regions = 51 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 4 ********** No masking Map Score: 3.07965e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.07965e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.07965e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0