AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i149_Thioredoxin_pyro_reg_100.orf -o149_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01313 224 Pyrococcus_OT3 Motif number 1 AATAGCGTTTTAAACCAATGGTTGAGGAGG 1 18 0 TAAACCAATG 0.979949 -207 CATTGGTTTAAAACGCTATTTTACTTCCTT 1 28 1 AAACGCTATT 0.878254 -197 AAGCTTTAAAAAACCCTTTTAAGATTTCTA 1 87 0 AAACCCTTTT 0.894872 -138 AAGGGTTTTTTAAAGCTTAGAATTGAAAAT 1 99 1 TAAAGCTTAG 0.940304 -126 CCAAAGATATTAAACCAAAGGTTGAACACT 1 132 0 TAAACCAAAG 0.974056 -93 GTGTATCACCAAAACCAAAGATATTAAACC 1 146 0 AAAACCAAAG 0.979953 -79 GTGAATATTTAAAAGCATTTTGGGGCACAA 1 178 0 AAAAGCATTT 0.659729 -47 ********** Masking position 3 Map Score: 7.37715 Number of sites scoring better than the average of aligned sites = 329 Number in coding regions = 292 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 2 AAACCTCCTCAACCATTGGTTTAAAACGCT 1 15 1 AACCATTGGT 0.988751 -210 AAAAGTGTTCAACCTTTGGTTTAATATCTT 1 129 1 AACCTTTGGT 0.996791 -96 TTTGGTTTAATATCTTTGGTTTTGGTGATA 1 143 1 TATCTTTGGT 0.987757 -82 ********** Masking position 2 Map Score: 3.75548 Number of sites scoring better than the average of aligned sites = 21 Number in coding regions = 17 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 3 AATAAGGAAGTAAAATAGCGTTTTAAACCA 1 31 0 TAAAATAGCG 0.988497 -194 TCTTCAGAGAGAAGATAGCGTAGAAATCTT 1 67 1 GAAGATAGCG 0.976637 -158 AAAACCCTTTTAAGATTTCTACGCTATCTT 1 78 0 TAAGATTTCT 0.919875 -147 GAATTGAAAATAAAAGTGTTCAACCTTTGG 1 118 1 TAAAAGTGTT 0.919931 -107 AAATATTCACTAAAAGAGCTACGTGGAGGT 1 198 1 TAAAAGAGCT 0.988501 -27 ********** Masking position 5 Map Score: 2.22574 Number of sites scoring better than the average of aligned sites = 367 Number in coding regions = 339 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 4 AGAAAAAATAAGGAAGTAAAATAGCGTTTT 1 37 0 AGGAAGTAAA 0.957408 -188 CTTCTCTCTGAAGAAGAAAAAATAAGGAAG 1 51 0 AAGAAGAAAA 0.935619 -174 AGAGAGAAGATAGCGTAGAAATCTTAAAAG 1 72 1 TAGCGTAGAA 0.910125 -153 TTTTAAAGCTTAGAATTGAAAATAAAAGTG 1 106 1 TAGAATTGAA 0.967229 -119 AAGAGCTACGTGGAGGTGAAGGAA 1 211 1 TGGAGGTGAA 0.987392 -14 ********** Masking position 9 Map Score: 0.816793 Number of sites scoring better than the average of aligned sites = 783 Number in coding regions = 700 Number in noncoding regions = 83 Number of orfs with sites within 600 bp upstream = 72 Fraction of orfs with sites within 600 bp upstream = 0.0115644 Motif number 5 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0