AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i150_ATP_synthase_1_pyro_reg_300.orf -o150_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01063 24 Pyrococcus_OT3 #2 RPH01058 31 Pyrococcus_OT3 #3 RPH01055 142 Pyrococcus_OT3 #4 RPH01052 137 Pyrococcus_OT3 Motif number 1 TGTTCTTTCTTTAATTTAGGAGGACAGA 2 9 1 CTTTAATTTA 0.931011 -23 GAAGATGAGCCTTTTATTTTGTTTTTTGTT 3 24 1 CTTTTATTTT 0.876222 -119 GATTATTGAACAATTATTTATAAACAAAAA 3 46 0 CAATTATTTA 0.923309 -97 AATAATTGTTCAATAATCCTAGCAAAAAAT 3 58 1 CAATAATCCT 0.885685 -85 AGATCATTGACATTCATTTAAAATATTTTT 3 82 0 CATTCATTTA 0.949884 -61 GTAATTCTCCCTATCATCCAAAGGAGATGG 3 118 1 CTATCATCCA 0.987096 -25 AACGTTTTGATTTTTATCCAAGATGGATGA 4 61 1 TTTTTATCCA 0.844543 -77 CTTTTGGTATCTATCATCCATCTTGGATAA 4 74 0 CTATCATCCA 0.987096 -64 ********** Masking position 6 Map Score: 6.56593 Number of sites scoring better than the average of aligned sites = 571 Number in coding regions = 524 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 69 Fraction of orfs with sites within 600 bp upstream = 0.0110826 Motif number 2 TCCTGTCACCTAGTAAAATGGAA 1 1 0 TAGAAAAGAA 0.9872 -24 TTCTTTAATTTAGGAGGACAGAAAG 2 17 1 TAGAGGAGAA 0.974035 -15 TCAATAATCCTAGCAAAAAATATTTTAAATGAA 3 67 1 TAGAAAATAT 0.954917 -76 TAGGGAGAATTACAAGAACAGATCATTGACATT 3 98 0 TACAGAAGAT 0.98794 -45 GGATGATAGATACCAAAAGTGATTTAACGAAAG 4 85 1 TACAAAAGAT 0.986993 -53 *** **** *** Masking position 8 Map Score: 0.986641 Number of sites scoring better than the average of aligned sites = 75 Number in coding regions = 69 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 3 TGTTCTTTCTTTAATTTAGGAGG 2 2 1 GTTCTTTTTA 0.98449 -30 CTTTTATTTTGTTTTTTGTTTATAAATAATTG 3 34 1 GTTTTTTTTA 0.990844 -109 GTTAAATTAAGTTTTATGTCTAACGTTTTGAT 4 40 1 GTTTTTTCTA 0.98449 -98 TATGTCTAACGTTTTGATTTTTATCCAAGATG 4 54 1 GTTTTATTTT 0.944289 -84 ***** * **** Masking position 5 Map Score: 0.303331 Number of sites scoring better than the average of aligned sites = 33 Number in coding regions = 23 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 ********** No masking Map Score: 2.51122e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.51122e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.51122e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0