AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i155_Hydrogenase_2_pyro_reg_300.orf -o155_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01185 211 Pyrococcus_OT3 Motif number 1 ATATTTAAGCCCCGCACCTTGACCTTTTATTT 1 21 0 CCCGACTTGA 0.998419 -191 ATCATCAAAGCTTGGTCTTTGAAAAAAAGAGT 1 67 1 CTTGTCTTGA 0.991584 -145 CGTTTTTAAACCCGAAAATTGAAAACCAAAGG 1 105 0 CCCGAATTGA 0.989866 -107 GCTTTTTTATCCTGGACTTTAACTCGTTATCG 1 136 1 CCTGACTTAA 0.996129 -76 GATGCTCATCCCTGATCCTCGATAACGAGTTA 1 155 0 CCTGTCTCGA 0.996422 -57 CATGGTTAATCCTGTTCATTAATGGAGGTGAT 1 186 1 CCTGTCTTAA 0.996129 -26 **** ** **** Masking position 9 Map Score: 13.2265 Number of sites scoring better than the average of aligned sites = 65 Number in coding regions = 57 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 2 GTCAAGGTGCGGGGCTTAAATATATTTATCAT 1 30 1 GGGGTTAAAA 0.995369 -182 ACCAAGCTTTGATGATTATATATGATAAATAT 1 51 0 GATGTTATAA 0.920618 -161 TTTCAATTTTCGGGTTTAAAAACGCTTTTTTA 1 113 1 CGGGTTAAAA 0.996816 -99 AGTTAAAGTCCAGGATAAAAAAGCGTTTTTAA 1 128 0 CAGGTAAAAA 0.988783 -84 CATTAATGAACAGGATTAACCATGATGCTCAT 1 178 0 CAGGTTAACA 0.992403 -34 **** ***** * Masking position 6 Map Score: 4.17981 Number of sites scoring better than the average of aligned sites = 87 Number in coding regions = 72 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 3 CCCGCACCTTGACCTTTTATTTGGTGAAAA 1 13 0 GACCTTTTAT 0.96162 -199 TTCAAAGACCAAGCTTTGATGATTATATAT 1 60 0 AAGCTTTGAT 0.983614 -152 AAGGTTGAGAACTCTTTTTTTCAAAGACCA 1 79 0 ACTCTTTTTT 0.956543 -133 AAGAGTTCTCAACCTTTGGTTTTCAATTTT 1 93 1 AACCTTTGGT 0.980107 -119 GGGTTTAAAAACGCTTTTTTATCCTGGACT 1 124 1 ACGCTTTTTT 0.983615 -88 ********** Masking position 5 Map Score: 3.37089 Number of sites scoring better than the average of aligned sites = 169 Number in coding regions = 139 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 4 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0