AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i198_enolase_pyro_reg_300.orf -o198_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01790 122 Pyrococcus_OT3 #2 RPH01791 41 Pyrococcus_OT3 Motif number 1 CTCCTTCACCTCCTCGCCAGGCCCGGTG 1 9 1 CCTCCTCGCC 0.998534 -114 GAAAGGGAACCCACCGGGCCTGGCGAGGAG 1 20 0 CCACCGGGCC 0.9974 -103 CTTTCGGACACCCCCGAGCCGTGCTAAGTG 1 45 1 CCCCCGAGCC 0.9974 -78 ********** Masking position 5 Map Score: 5.43295 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 12 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 CCTGGCGAGGAGGTGAAGGAG 1 2 0 AGGTGAAGGA 0.993225 -121 CTATCACCAAAGAAGATAGAATAAAAGCGA 2 19 0 AGAAGATAGA 0.984606 -23 CTATCTTCTTTGGTGATAGACC 2 30 1 TGGTGATAGA 0.994289 -12 ********** Masking position 6 Map Score: 0.979802 Number of sites scoring better than the average of aligned sites = 118 Number in coding regions = 109 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 CGGCTCGGGGGTGTCCGAAAGGGAACCCACC 1 35 0 GGTCCGAAAG 0.97966 -88 ATGCAATCATGGGTTATAAAGTACCTTTAAA 1 78 1 GGTTATAAAG 0.988693 -45 CTTAAGTAAAGATTTTTAAAGGTACTTTATA 1 92 0 GTTTTTAAAG 0.974872 -31 CACTTGGAATCTTAAGTAAAGATTTT 1 107 0 GAATCTTAAG 0.927194 -16 TAGAATAAAAGCGATTTAAATA 2 2 0 GGATTTAAAT 0.953752 -40 * ********* Masking position 9 Map Score: 0.154822 Number of sites scoring better than the average of aligned sites = 398 Number in coding regions = 368 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 4 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 5.92755e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0