AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i223_Pseudouridylate_Synthase_pyro_reg_100.orf -o223_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01735 233 Pyrococcus_OT3 #2 RPH01736 42 Pyrococcus_OT3 Motif number 1 CTTGTTTTTGTCAAAAATCCTTTTAAGTAA 1 29 0 TCAAAAATCC 0.976134 -205 CGTCTCTCCTTTAAAAAACTTTGCTAGCTT 1 56 0 TTAAAAAACT 0.969958 -178 AGGAGAGACGTCAAAGAACTAATTTGATGA 1 76 1 TCAAAGAACT 0.996962 -158 GTTCGAAAAATCAAAGAAGTTCATTGCTTT 1 141 0 TCAAAGAAGT 0.989385 -93 AACCAAAGATTCAAAAATCTTTCGGAACAG 1 182 0 TCAAAAATCT 0.991139 -52 GGTTAACATTTCAAAGAAATTCCGAGGTGG 1 208 1 TCAAAGAAAT 0.984347 -26 ********** Masking position 5 Map Score: 11.14 Number of sites scoring better than the average of aligned sites = 147 Number in coding regions = 135 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 2 AAAACTTTGCTAGCTTGTTTTTGTCAAAAA 1 42 0 TAGCTTGTTT 0.966815 -192 TTAAAGCTGATATCTTGTTCCCTAATCATC 1 101 0 TATCTTGTTC 0.984524 -133 AAGAAGTTCATTGCTTTTACTAATTCGTTA 1 128 0 TTGCTTTTAC 0.967271 -106 ATGAACTTCTTTGATTTTTCGAACATGCTA 1 147 1 TTGATTTTTC 0.975892 -87 AACAGTTGGATAGCATGTTCGAAAAATCAA 1 157 0 TAGCATGTTC 0.978753 -77 ACTTTATTTTTCCACCTTCTTA 2 3 1 TTTATTTTTC 0.931872 -40 ********** Masking position 6 Map Score: 6.6313 Number of sites scoring better than the average of aligned sites = 399 Number in coding regions = 368 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 3 CCGAAAGATTTTTGAATCTTTGGTTAACAT 1 187 1 TTTGAATCTT 0.929744 -47 TCCTTACCACCTCGGAATTTCTT 1 221 0 TTACCACCTC 0.985813 -13 ACTTTATTTTTCCACCTTCTTATTTATT 2 9 1 TTTCCACCTT 0.995236 -34 GATTTGCACCTATTAATAAATA 2 31 0 TTTGCACCTA 0.991618 -12 ********** Masking position 6 Map Score: 2.11127 Number of sites scoring better than the average of aligned sites = 69 Number in coding regions = 64 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0