AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i227_rna_methyltransferase_pyro_reg_300.orf -o227_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00468 128 Pyrococcus_OT3 Motif number 1 TCTTCATCACCAAAAAGAATTTACCTTCT 1 10 1 CCAAAAAGAA 0.989644 -119 GCTTTAAATACCTAAAGAAGGTAAATTCTT 1 25 0 CCTAAAGAAG 0.982155 -104 AAACCTCAAGCCAAAAGCAAGCTTTAAATA 1 45 0 CCAAAAGCAA 0.996337 -84 TTCATAGTTGCCAAAACCGACATCCTAATA 1 73 1 CCAAAACCGA 0.985204 -56 AAACCGACATCCTAATAAAATTCCTGGATG 1 86 1 CCTAATAAAA 0.960138 -43 ********** Masking position 5 Map Score: 5.42561 Number of sites scoring better than the average of aligned sites = 128 Number in coding regions = 105 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 2 AATTCTTTTTGGTGATGAAGA 1 2 0 GGTGATGAAG 0.991304 -127 AATACCTAAAGAAGGTAAATTCTTTTTGGT 1 19 0 GAAGGTAAAT 0.979464 -110 AAAATTCCTGGATGGAGATTAAGGAGGTGA 1 102 1 GATGGAGATT 0.967401 -27 TGGAGATTAAGGAGGTGAAGGGTGA 1 114 1 GGAGGTGAAG 0.997799 -15 ********** Masking position 8 Map Score: 2.77301 Number of sites scoring better than the average of aligned sites = 522 Number in coding regions = 458 Number in noncoding regions = 64 Number of orfs with sites within 600 bp upstream = 76 Fraction of orfs with sites within 600 bp upstream = 0.0122069 Motif number 3 CCTAAAGAAGGTAAATTCTTTTTGGTGATG 1 15 0 GTAAATTCTT 0.933307 -114 AAAGCAAGCTTTAAATACCTAAAGAAGGTA 1 32 0 TTAAATACCT 0.989583 -97 TTTTGGCAACTATGAAACCTCAAGCCAAAA 1 59 0 TATGAAACCT 0.897225 -70 GACATCCTAATAAAATTCCTGGATGGAGAT 1 91 1 TAAAATTCCT 0.989494 -38 ********** Masking position 5 Map Score: 0.441311 Number of sites scoring better than the average of aligned sites = 356 Number in coding regions = 301 Number in noncoding regions = 55 Number of orfs with sites within 600 bp upstream = 72 Fraction of orfs with sites within 600 bp upstream = 0.0115644 Motif number 4 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0