AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i251_chemotaxis_pyro_reg_100.orf -o251_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RPH00607 300 Pyrococcus_OT3 Input sequences: #1 RPH00606 300 Pyrococcus_OT3 #2 RPH00604 17 Pyrococcus_OT3 Motif number 1 TTTTTACATATTTTAACGAAGGTCATAATTG 1 86 0 TTTTAAGAAG 0.995738 -215 TCGTTAAAATATGTAAAAAAGTTTTCGTCTC 1 98 1 ATGTAAAAAG 0.937916 -203 TCGTCTCTTCTTTTAATGAAGCCTAGTAGTT 1 122 1 TTTTAAGAAG 0.993726 -179 AAAATATTTTTATTAAGGAAGGTTTATCATT 1 214 1 TATTAAGAAG 0.986512 -87 AGGTTTATCATTGTATAGAAGCCGAAAATAT 1 233 1 TTGTATGAAG 0.987476 -68 ****** **** Masking position 5 Map Score: 6.07522 Number of sites scoring better than the average of aligned sites = 49 Number in coding regions = 38 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 2 ATGAAGAGTTCATAAGTCTTCCTGGGTCATG 1 43 0 CATAAGCTTC 0.933894 -258 GATGTAAAACTACTAGGCTTCATTAAAAGAA 1 129 0 TACTAGCTTC 0.978446 -172 GCCTAGTAGTTTTACATCTCCATTTTTGAAG 1 142 1 TTTACACTCC 0.912776 -159 TTTGTAGATTTTCTAAACTTCAAAAATGGAG 1 159 0 TTCTAACTTC 0.966521 -142 TTAGAAAATCTACAAAGCTACCTACACAACT 1 174 1 TACAAACTAC 0.969989 -127 CAAAGCTACCTACACAACTACGTGCATAAAA 1 186 1 TACACACTAC 0.969401 -115 TCTATACAATGATAAACCTTCCTTAATAAAA 1 221 0 GATAAACTTC 0.935119 -80 GATCATGATATTTTCGGCTTCTATACAATGA 1 240 0 TTTTCGCTTC 0.945906 -61 ****** **** Masking position 9 Map Score: 5.80337 Number of sites scoring better than the average of aligned sites = 364 Number in coding regions = 330 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 3 ATGATAATAAGGTTATCCTAAAATAAAAAT 1 16 0 GGTTATCCTA 0.919617 -285 AGTCTTCCTGGGTCATGATAATAAGGTTAT 1 30 0 GGTCATGATA 0.985477 -271 AAAATGAAGAGTTCATAAGTCTTCCTGGGT 1 47 0 GTTCATAAGT 0.906392 -254 TTTTAACGAAGGTCATAATTGGTAGTGAGC 1 77 0 GGTCATAATT 0.982274 -224 ATTAAGGAAGGTTTATCATTGTATAGAAGC 1 225 1 GTTTATCATT 0.932723 -76 TATCTAAGACGATCATGATATTTTCGGCTT 1 251 0 GATCATGATA 0.902349 -50 ********** Masking position 5 Map Score: 3.56197 Number of sites scoring better than the average of aligned sites = 157 Number in coding regions = 142 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 4 GACTTATGAACTCTTCATTTTGCTCACTAC 1 56 1 CTCTTCATTT 0.993817 -245 AAGTTTTCGTCTCTTCTTTTAATGAAGCCT 1 116 1 CTCTTCTTTT 0.989152 -185 GTAGTTTTACATCTCCATTTTTGAAGTTTA 1 147 1 ATCTCCATTT 0.980195 -154 ********** Masking position 4 Map Score: 1.90231 Number of sites scoring better than the average of aligned sites = 64 Number in coding regions = 56 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 5 ********** No masking Map Score: -8.2833e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -8.2833e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -8.2833e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0