AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i271_hypothetical16_pyro_reg_300.orf -o271_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00534 20 Pyrococcus_OT3 #2 RPH00533 119 Pyrococcus_OT3 #3 RPH00532 300 Pyrococcus_OT3 Motif number 1 TTGGAAGTTTAACTCTGGTAACCCCTCA 2 3 0 ATTGGACCCT 0.969867 -117 CATCTCCTGAGTTGCTGGATCCCACCTGGTGTGAGA 2 76 0 GGTGGTCCCC 0.994677 -44 TTCAGAAAAGAGCAATGGTAGCCCCGCGGGGATTCG 3 66 1 AATGGACCCG 0.994259 -235 TCCCGCGACCGGGGTTCGAATCCCCGCGGGGCTACC 3 82 0 GGTCGACCCG 0.996748 -219 AAGCATGCGGGACTCTGGATCCCGCGACCGGGGTTC 3 101 0 GTTGGTCCCG 0.996105 -200 TTGAGTGAAAATTGGACGTAGCCCCGTGGTGTAGCG 3 140 0 AGACGACCCG 0.980131 -161 TAGAAATTTTAAAGGAGGAATCTGCCTAAACGGCTT 3 209 0 AGAGGACTCC 0.918578 -92 TGTATATTAAGTTTTTGGCTTCCTCGCCTAGAAATT 3 237 0 GTTGGTCCCG 0.996105 -64 TAATATACAGGGAAATGGTAACTTCGTTAAATCCGG 3 264 1 GATGGACTCG 0.985293 -37 * * *** * ** ** Masking position 12 Map Score: 14.166 Number of sites scoring better than the average of aligned sites = 125 Number in coding regions = 107 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 2 TTTCAATACCTCCTACTAAT 1 4 0 TACCTCTACT 0.856847 -17 AGAGTTAAACTTCCAACTACCTATATACAAC 2 23 1 TTCCACTACC 0.992786 -97 ACTACCTATATACAACTTCCCCTCCATTTTA 2 38 1 TACAATTCCC 0.965474 -82 TATTCACTTTTTCCATCTCCTGAGTTGCTGG 2 94 0 TTCCACTCCT 0.987267 -26 AAGTCCATGCTTTCATTTACCACTTGAAGTG 3 21 0 TTTCATTACC 0.936635 -280 GCGACCGGGGTTCGAATCCCCGCGGGGCTAC 3 83 0 TTCGATCCCC 0.943199 -218 TTAACGAAGTTACCATTTCCCTGTATATTAA 3 263 0 TACCATTCCC 0.994498 -38 ***** ***** Masking position 1 Map Score: 4.77551 Number of sites scoring better than the average of aligned sites = 673 Number in coding regions = 633 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 3 ATACAACTTCCCCTCCATTTTAGTTTGGGTCTC 2 47 1 CCTCCTTTAG 0.938057 -73 CAGGTGGGATCCAGCAACTCAGGAGATGGAAAA 2 84 1 CCGCATCAGG 0.986161 -36 GCAACCCCCGCACTTCAAGTGGTAAATGA 3 7 1 CCGCATCAAG 0.99278 -294 GATCCAGAGTCCCGCATGCTTGGCCGCTACACC 3 116 1 CCGCACTTGG 0.972346 -185 ACTCAACGTTAATGCCTTTTAAGCTTTGCGGTT 3 170 1 AAGCCTTAAG 0.904731 -131 CGGTTTTATTCAAGCCGTTTAGGCAGATTCCTC 3 198 1 CAGCCTTAGG 0.988602 -103 TTACCATTTCCCTGTATATTAAGTTTTTGGCTT 3 252 0 CCGTATTAAG 0.966453 -49 ** *** ***** Masking position 13 Map Score: 3.64195 Number of sites scoring better than the average of aligned sites = 185 Number in coding regions = 160 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 4 TTTGGGTCTCACACCAGGTGGGATCCAGCA 2 70 1 ACACCAGGTG 0.979166 -50 ATGCTTTCATTTACCACTTGAAGTGCGGGG 3 16 0 TTACCACTTG 0.919749 -285 GGGGTTCGAATCCCCGCGGGGCTACCATTG 3 78 0 TCCCCGCGGG 0.987072 -223 CTTGGCCGCTACACCACGGGGCTACGTCCA 3 134 1 ACACCACGGG 0.997295 -167 TTTATTCACCACCGGATTTAACGAA 3 286 0 TCACCACCGG 0.995012 -15 ********** Masking position 5 Map Score: 4.07064 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 36 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 5 TAAAATGGAGGGGAAGTTGTATATAGGTAG 2 39 0 GGGAAGTTGT 0.985938 -81 TTTCAGAAAAGAGCAATGGTAGCCCCGCGG 3 65 1 GAGCAATGGT 0.985938 -236 TTAATATACAGGGAAATGGTAACTTCGTTA 3 263 1 GGGAAATGGT 0.995624 -38 ********** Masking position 5 Map Score: 0.131603 Number of sites scoring better than the average of aligned sites = 14 Number in coding regions = 14 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0