AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i277_hypothetical21_pyro_reg_100.orf -o277_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00744 36 Pyrococcus_OT3 #2 RPH00015 89 Pyrococcus_OT3 Motif number 1 CGGGAAATTGTATAAGGGAGAGAATAT 1 7 1 ATTTATAAGG 0.99822 -30 TAAGGGAGAGAATATATAAGGTTG 1 23 1 AATTATAAGG 0.995513 -14 TATTCAAAAAATTTTATAATGTTCCCAAAGA 2 24 0 ATTTATAATG 0.992945 -66 AGAAATCCCTATTACATAGGGATTTTAAACT 2 59 0 ATTCATAGGG 0.994845 -31 *** ******* Masking position 6 Map Score: 7.02481 Number of sites scoring better than the average of aligned sites = 52 Number in coding regions = 43 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 CCCTATTACATAGGGATTTTAAACTATTTT 2 54 0 TAGGGATTTT 0.997559 -36 CCCTATGTAATAGGGATTTCTAGGTGACAG 2 69 1 TAGGGATTTC 0.998345 -21 ********** Masking position 6 Map Score: 2.21925 Number of sites scoring better than the average of aligned sites = 7 Number in coding regions = 5 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.82309e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0