AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i294_mixed1_pyro_reg_100.orf -o294_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RPH01295 16 Pyrococcus_OT3 Input sequences: #1 RPH00435 225 Pyrococcus_OT3 #2 RPH01219 16 Pyrococcus_OT3 #3 RPH01220 64 Pyrococcus_OT3 #4 RPH01291 61 Pyrococcus_OT3 #5 RPH01292 23 Pyrococcus_OT3 #6 RPH01294 90 Pyrococcus_OT3 #7 RPH01750 184 Pyrococcus_OT3 Motif number 1 TCAGGGGGTGTGAGAA 2 5 1 GGGGTGTGAG 0.981182 -12 AAGCTTTCTTGAGAAGTTAAGGCT 4 5 0 GAGAAGTTAA 0.814037 -57 ATCGGCGTTTGGGGAGTTAACTTTTAAGCT 4 30 0 GGGGAGTTAA 0.994199 -32 AAACGCCGATGGGGAGCGAACC 4 50 1 GGGGAGCGAA 0.988186 -12 AATTCTCAAGGGGAAGTGGAGGAAATGGAG 6 29 0 GGGAAGTGGA 0.989962 -62 CTAAACCATCGGGGTGTTGCAA 6 79 1 GGGGTGTTGC 0.981182 -12 TCACGATCAAGGGGTGATGATC 7 3 0 GGGGTGATGA 0.97236 -182 GCATTTTATTGGGGATTGGAA 7 174 1 GGGGATTGGA 0.979654 -11 ********** Masking position 3 Map Score: 10.6577 Number of sites scoring better than the average of aligned sites = 361 Number in coding regions = 323 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 2 TCAGATTAATTGAAAGCTTAAGGGGGCAAAAAAG 1 11 0 TGAACTTAGG 0.934465 -215 ATCTAACTTAAAAACTCTAGATTGAACTCAGATT 1 38 0 AAAACTAATG 0.892223 -188 AGACATTACGACAATTGTCAAATGCTATCATTAC 1 98 1 ACAAGTCAAG 0.95685 -128 AGTACAATCTAAAATCGTTGATCGCCGAATATAT 1 136 0 AAAAGTTATG 0.941022 -90 AAGTCTTTTATAAAGGGTTGAAAGGCTAATAGGT 1 178 1 TAAAGTTAAG 0.9624 -48 TAACTTCTCAAGAAAGCTTAAAAGTTAACTCCCC 4 16 1 AGAACTTAAG 0.967661 -46 GTTAAATACTAAAAAGGAGAGAC 5 8 0 TAAACTAAAG 0.929974 -16 GAACAGAAGAAAAATTCTCAAGGGGAAGTGGAGG 6 37 0 AAAACTCAGG 0.963567 -54 TATGCTCACTTCAAAGGTCAAAGGATAATGATAG 7 70 1 TCAAGTCAAG 0.949137 -115 AGTAAAGCGTTGAAAAGTCTAAAGCTATCATTAT 7 94 0 TGAAGTCAAG 0.964515 -91 AATCCCCAATAAAATGCTTCATTGTGAGCTAATA 7 157 0 AAAACTTATG 0.950074 -28 **** *** ** * Masking position 4 Map Score: 10.5394 Number of sites scoring better than the average of aligned sites = 337 Number in coding regions = 283 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 65 Fraction of orfs with sites within 600 bp upstream = 0.0104401 Motif number 3 AATTAATCTGAGTTCAATCTAGAGTTTTTAAGT 1 34 1 AGTTCAATGA 0.959224 -192 TTTCGGTAATAGTACAATCTAAAATCGTTGATC 1 147 0 AGTACAATAA 0.97081 -79 ATATGTTATGAGTACACTAATAAATAGTTTTGC 3 25 1 AGTACACAAA 0.934473 -40 GCGTTTGGGGAGTTAACTTTTAAGCTTTCTTGA 4 23 0 AGTTAACTAA 0.953448 -39 TAAACCCATCGGTTCACGATCAAGGGGTGATGA 7 13 0 GGTTCACTAA 0.979833 -172 TTATAAACCTAGTTCAACTTAAACCCATCGGTT 7 32 0 AGTTCAATAA 0.987089 -153 AAAATTTATTAGCTCACAATGAAGCATTTTATT 7 151 1 AGCTCACTAA 0.979833 -34 ******* * ** Masking position 6 Map Score: 4.97234 Number of sites scoring better than the average of aligned sites = 93 Number in coding regions = 88 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 4 TTTGCCCCCTTAAGCTTTCAATTAATCTGAGTT 1 15 1 TAGCTTTCTT 0.934489 -211 ACAATTGTCAAATGCTATCATTACCTACATATA 1 108 1 AAGCTATCTA 0.985655 -118 CCCTTTATAAAAGACTTTCGGTAATAGTACAAT 1 162 0 AAACTTTCTA 0.977318 -64 AGTTAACTTTTAAGCTTTCTTGAGAAGTTAAGG 4 13 0 TAGCTTTCGA 0.954839 -49 AATCGAAAACTTTATATACTCCATTTCC 6 6 1 AAACTTTATA 0.921593 -85 TGAAAAGTCTAAAGCTATCATTATCCTTTGACC 7 85 0 AAGCTATCTA 0.985655 -100 TAGACTTTTCAACGCTTTACTTATTCATGAGGT 7 107 1 AAGCTTTATA 0.977308 -78 ** ****** ** Masking position 2 Map Score: 5.80484 Number of sites scoring better than the average of aligned sites = 181 Number in coding regions = 159 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 5 TTGAAAGCTTAAGGGGGCAAAAAAG 1 5 0 AAGGGGCAAA 0.952068 -221 ATGTAGTTTTCGGTGGAGGTACTAAGACATT 1 74 1 CGGTGGGGTA 0.832676 -152 GAATATATGTAGGTAATGATAGCATTTGACA 1 113 0 AGGTAAGATA 0.855848 -113 GTCTTTTATAAAGGGTTGAAAGGCTAATAGG 1 180 1 AAGGGTGAAA 0.840585 -46 AAAGGCTAATAGGTGAAGAAAAGAAAAGGTG 1 198 1 AGGTGAGAAA 0.97863 -28 AGAAAAGAAAAGGTGATGAAGA 1 214 1 AGGTGAGAAG 0.946168 -12 AACATATACCAGGTGACCCTA 3 1 0 AGGTGACCTA 0.839927 -64 TCAAGGATTAAAGTAGGCAAAACTATTTATT 3 43 0 AAGTAGCAAA 0.830098 -22 TCTCAAGGGGAAGTGGAGGAAATGGAGTATA 6 25 0 AAGTGGGGAA 0.959016 -66 GTTCACGATCAAGGGGTGATGATC 7 4 0 AAGGGGGATG 0.916725 -181 TTGACCTTTGAAGTGAGCATAAATATTTATA 7 60 0 AAGTGACATA 0.943615 -125 ****** **** Masking position 3 Map Score: 6.66106 Number of sites scoring better than the average of aligned sites = 1035 Number in coding regions = 925 Number in noncoding regions = 110 Number of orfs with sites within 600 bp upstream = 126 Fraction of orfs with sites within 600 bp upstream = 0.0202377 Motif number 6 GCCCCCTTAAGCTTTCAATTAATCTGAGTT 1 18 1 GCTTTCAATT 0.896859 -208 ATTGTCAAATGCTATCATTACCTACATATA 1 111 1 GCTATCATTA 0.985007 -115 TAACTTTTAAGCTTTCTTGAGAAGTTAAGG 4 13 0 GCTTTCTTGA 0.943754 -49 AAAGTCTAAAGCTATCATTATCCTTTGACC 7 85 0 GCTATCATTA 0.985007 -100 ACTTTTCAACGCTTTACTTATTCATGAGGT 7 110 1 GCTTTACTTA 0.913653 -75 ********** Masking position 5 Map Score: 1.03161 Number of sites scoring better than the average of aligned sites = 159 Number in coding regions = 148 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 7 ********** No masking Map Score: 1.5372e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.5372e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 1.5372e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0