AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i294_mixed1_pyro_reg_300.orf -o294_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RPH01295 16 Pyrococcus_OT3 Input sequences: #1 RPH00435 225 Pyrococcus_OT3 #2 RPH01219 16 Pyrococcus_OT3 #3 RPH01220 64 Pyrococcus_OT3 #4 RPH01291 61 Pyrococcus_OT3 #5 RPH01292 23 Pyrococcus_OT3 #6 RPH01294 90 Pyrococcus_OT3 #7 RPH01750 184 Pyrococcus_OT3 Motif number 1 TTCTCACACCCCCTGA 2 5 0 CTCACACCCC 0.98148 -12 AGCCTTAACTTCTCAAGAAAGCTT 4 5 1 TTAACTTCTC 0.816489 -57 AGCTTAAAAGTTAACTCCCCAAACGCCGAT 4 30 1 TTAACTCCCC 0.994292 -32 GGTTCGCTCCCCATCGGCGTTT 4 50 0 TTCGCTCCCC 0.988375 -12 CTCCATTTCCTCCACTTCCCCTTGAGAATT 6 29 1 TCCACTTCCC 0.990123 -62 TTGCAACACCCCGATGGTTTAG 6 79 0 GCAACACCCC 0.98148 -12 GATCATCACCCCTTGATCGTGA 7 3 1 TCATCACCCC 0.972794 -182 TTCCAATCCCCAATAAAATGC 7 174 0 TCCAATCCCC 0.979976 -11 ********** Masking position 8 Map Score: 10.6577 Number of sites scoring better than the average of aligned sites = 361 Number in coding regions = 323 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 2 CTCAGATTAATTGAAAGCTTAAGGGGGCAAAAAAG 1 11 0 TTGAACTTAG 0.959735 -215 AATCTAACTTAAAAACTCTAGATTGAACTCAGATT 1 38 0 AAAAACTAAG 0.899013 -188 AAGACATTACGACAATTGTCAAATGCTATCATTAC 1 97 1 GACAAGTCAG 0.851536 -129 TAGTACAATCTAAAATCGTTGATCGCCGAATATAT 1 136 0 TAAAAGTTAG 0.954252 -90 AAAGTCTTTTATAAAGGGTTGAAAGGCTAATAGGT 1 177 1 ATAAAGTTAG 0.946101 -49 TTAACTTCTCAAGAAAGCTTAAAAGTTAACTCCCC 4 15 1 AAGAACTTAG 0.952512 -47 GTTAAATACTAAAAAGGAGAGAC 5 8 0 TTAAACTAAG 0.913635 -16 AGAACAGAAGAAAAATTCTCAAGGGGAAGTGGAGG 6 37 0 AAAAACTCAG 0.963431 -54 GATCATCACCCCTTGATCGTGAACCGATG 7 5 1 ATCACCTTAG 0.774945 -180 TTATGCTCACTTCAAAGGTCAAAGGATAATGATAG 7 69 1 TTCAAGTCAG 0.949085 -116 AAGTAAAGCGTTGAAAAGTCTAAAGCTATCATTAT 7 94 0 TTGAAGTCAG 0.949084 -91 CAATCCCCAATAAAATGCTTCATTGTGAGCTAATA 7 157 0 TAAAACTTAG 0.966552 -28 ***** *** * * Masking position 4 Map Score: 10.5185 Number of sites scoring better than the average of aligned sites = 331 Number in coding regions = 281 Number in noncoding regions = 50 Number of orfs with sites within 600 bp upstream = 61 Fraction of orfs with sites within 600 bp upstream = 0.00979762 Motif number 3 TTTGCCCCCTTAAGCTTTCAATTAATCTGAG 1 15 1 TAAGTTTCAA 0.721031 -211 TAGGTAATGATAGCATTTGACAATTGTCGTA 1 104 0 TAGCTTTGAC 0.983325 -122 CTTCACCTATTAGCCTTTCAACCCTTTATAA 1 185 0 TAGCTTTCAA 0.956416 -41 TGGTATATGTTATGAGTACACTAATAAATAG 3 21 1 TATGGTACAC 0.911075 -44 AACTTAAACCCATCGGTTCACGATCAAGGGG 7 19 0 CATCGTTCAC 0.923628 -166 AAGCTATCATTATCCTTTGACCTTTGAAGTG 7 76 0 TATCTTTGAC 0.966162 -109 AGGATAATGATAGCTTTAGACTTTTCAACGC 7 91 1 TAGCTTAGAC 0.955729 -94 TAAATTTTGGTAGGGGTTCACCTCATGAATA 7 128 0 TAGGGTTCAC 0.982994 -57 **** ****** Masking position 2 Map Score: 4.68746 Number of sites scoring better than the average of aligned sites = 192 Number in coding regions = 176 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 4 TGCCCCCTTAAGCTTTCAATTAATCTGAGTTCAA 1 17 1 AGCTTCTAAT 0.814666 -209 AATTAATCTGAGTTCAATCTAGAGTTTTTAAGTT 1 34 1 AGTTAATGAG 0.914282 -192 AGATTTATGTAGTTTTCGGTGGAGGTACTAAGAC 1 68 1 AGTTTCTGAG 0.966002 -158 ACTATTTATTAGTGTACTCATAACATATACCAGG 3 19 0 AGTGACAAAC 0.834131 -46 GCGTTTGGGGAGTTAACTTTTAAGCTTTCTTGAG 4 22 0 AGTTACTAAG 0.991053 -40 CCGATGGTTTAGTTTTCCCAGAACAGAAGAAAAA 6 57 0 AGTTTCAAAC 0.918636 -34 TAAACCCATCGGTTCACGATCAAGGGGTGATGAT 7 12 0 GGTTACTAAG 0.962804 -173 TTATAAACCTAGTTCAACTTAAACCCATCGGTTC 7 31 0 AGTTAATAAC 0.930611 -154 AAAATTTATTAGCTCACAATGAAGCATTTTATTG 7 151 1 AGCTACTAAG 0.981873 -34 **** ** * *** Masking position 13 Map Score: 4.05996 Number of sites scoring better than the average of aligned sites = 239 Number in coding regions = 221 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 5 CCTTTTCTTTTCTTCACCTATTAGCCTTTCAA 1 195 0 TCTCACCTTT 0.992752 -31 TCTTCATCACCTTTTCTTTTCTTCA 1 211 0 TCTCACCTTT 0.992752 -15 TAGGGTCACCTGGTATATGTTATG 3 3 1 GGTCACCTGT 0.981838 -62 GTCTCTCCTTTTTAGTATTTAA 5 1 1 GTTCTCCTTT 0.918389 -23 GATCATCACCCCTTGATCGTGAAC 7 3 1 TCTCACCCTT 0.976821 -182 ACTTTTCAACGCTTTACTTATTCATGAGGTGA 7 110 1 GCTTACTTTT 0.826365 -75 TTTTGGTAGGGGTTCACCTCATGAATAAGTAA 7 123 0 GGTCACCTAT 0.973316 -62 ** ****** ** Masking position 4 Map Score: 4.59938 Number of sites scoring better than the average of aligned sites = 123 Number in coding regions = 105 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 6 AAGTTAGATTTATGTAGTTTTCGGTGGAGGT 1 63 1 TATTAGTTTT 0.971754 -163 GAAAGTCTTTTATAAAGGGTTGAAAGGCTAA 1 176 1 TATAAGGGTT 0.845455 -50 AGTACACTAATAAATAGTTTTGCCTACTTTA 3 35 1 TAATAGTTTT 0.963507 -30 AAATGGAGTATATAAAGTTTTCGATT 6 6 0 TATAAGTTTT 0.963532 -85 ACACCCCGATGGTTTAGTTTTCCCAGAACAG 6 65 0 GGTTAGTTTT 0.876899 -26 GGTTTAAGTTGAACTAGGTTTATAAATATTT 7 40 1 GAATAGGTTT 0.922846 -145 CATTGTGAGCTAATAAATTTTGGTAGGGGTT 7 141 0 TAAAAATTTT 0.724662 -44 *** ******* Masking position 6 Map Score: 1.11245 Number of sites scoring better than the average of aligned sites = 183 Number in coding regions = 137 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 63 Fraction of orfs with sites within 600 bp upstream = 0.0101189 Motif number 7 TAAAAACTCTAGATTGAACTCAGATTAATT 1 34 0 AGATTGAACT 0.977221 -192 AAAACTACATAAATCTAACTTAAAAACTCT 1 54 0 AAATCTAACT 0.918227 -172 CAACGATTTTAGATTGTACTATTACCGAAA 1 150 1 AGATTGTACT 0.94846 -76 AGAAAGCTTAAAAGTTAACTCCCCAAACGC 4 26 1 AAAGTTAACT 0.918844 -36 CGATGGGTTTAAGTTGAACTAGGTTTATAA 7 35 1 AAGTTGAACT 0.962037 -150 ********** Masking position 8 Map Score: 0.670061 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 82 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 8 ********** No masking Map Score: 1.5372e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 1.5372e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 1.5372e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0