AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i316_mixed3_pyro_reg_100.orf -o316_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01790 122 Pyrococcus_OT3 Motif number 1 CACCGGGCCTGGCGAGGAGGTGAAGGAG 1 9 0 GGCGAGGAGG 0.998932 -114 CTCCTCGCCAGGCCCGGTGGGTTCCCTTTC 1 20 1 GGCCCGGTGG 0.996768 -103 CACTTAGCACGGCTCGGGGGTGTCCGAAAG 1 45 0 GGCTCGGGGG 0.996768 -78 ********** Masking position 6 Map Score: 6.23369 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 12 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 GCCTGGCGAGGAGGTGAAGGAG 1 2 0 GAGGTGAGGA 0.984988 -121 GGAACCCACCGGGCCTGGCGAGGAGGTGAAG 1 14 0 GGGCCTGCGA 0.995406 -109 GCACGGCTCGGGGGTGTCCGAAAGGGAACCC 1 38 0 GGGGTGCCGA 0.997473 -85 GGACACCCCCGAGCCGTGCTAAGTGATCATG 1 50 1 GAGCCGGCTA 0.991564 -73 ****** **** Masking position 11 Map Score: 0.839235 Number of sites scoring better than the average of aligned sites = 93 Number in coding regions = 86 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 TAAAGATTTTTAAAGGTACTTTATAACCCA 1 87 0 TAAAGGTACT 0.985177 -36 GAATCTTAAGTAAAGATTTTTAAAGGTACT 1 97 0 TAAAGATTTT 0.975889 -26 AAATCTTTACTTAAGATTCCAAGTG 1 108 1 TTAAGATTCC 0.98508 -15 ********** Masking position 4 Map Score: 0.12119 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 97 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.23224e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0