AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i321_mixed6_pyro_reg_100.orf -o321_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01107 45 Pyrococcus_OT3 #2 RPH01557 59 Pyrococcus_OT3 #3 RPH01559 70 Pyrococcus_OT3 #4 RPH01560 55 Pyrococcus_OT3 #5 RPH01561 233 Pyrococcus_OT3 Motif number 1 GTTGAAAGATTAAAAGTTGCAAATT 1 5 1 AAAGATTAAA 0.970141 -41 CCTTTTTACAAAAATTTAATATCTTATAAAG 2 15 1 AAAATTTATA 0.857929 -45 TTTCTCCGCAAAAGATTTATAATTCCTGGAA 3 31 1 AAAGATTATA 0.989796 -40 TAATACTAAAAAAGAAAGAAACA 4 3 0 AAAGAAAAAA 0.761502 -53 GAAATCTACTTAAAAATAATACTAAAAAAGA 4 19 0 TAAAAATATA 0.766067 -37 TCTTTATTGTAAAGGTTCATAAGCATCCATT 5 72 0 AAAGGTTATA 0.964614 -162 ATAAGGATTCAATGAATTATAAATAATTGGA 5 117 0 AATGAATATA 0.885971 -117 GAGAAATCCGAAAAATTTATATAGTTTTTCC 5 173 1 AAAAATTATA 0.970619 -61 TTTGAAATGAAAAGACTGATAGGAGGTGTTG 5 210 1 AAAGACTATA 0.974086 -24 ******* *** Masking position 9 Map Score: 8.90303 Number of sites scoring better than the average of aligned sites = 294 Number in coding regions = 209 Number in noncoding regions = 85 Number of orfs with sites within 600 bp upstream = 93 Fraction of orfs with sites within 600 bp upstream = 0.0149374 Motif number 2 AAAAGTTGCAAATTAAATTAGTTTTGGTGATTGA 1 22 1 AATAAAGTTT 0.844825 -24 AGTAACTCCCAGAGTTTTTATTACCTTT 2 42 0 AATCCAGTTT 0.98798 -18 GTTGAAATTTCTTCAAGCTATTTCTCCGCAA 3 7 1 ATTCTAGTAT 0.878434 -64 AAAGATTTATAATTCCTGGAACTATCAACTCCACG 3 41 1 AATCCAATAT 0.98879 -30 TTTTAAGTAGATTTCCATGAGCTATTCTTCG 4 35 1 ATTCCAGTAT 0.98046 -21 GAACATGCTCAAATACTCCAATTATTTATAATTCA 5 101 1 AATACAATAT 0.952797 -133 GCCAAATAAGGATTCAATGAATTATAAATAATTGG 5 118 0 GATCAAATAT 0.864784 -116 CAGGCATGAGAAATCCGAAAAATTTATATAGTTTT 5 166 1 AATCCAATTT 0.967426 -68 ** *** ** *** Masking position 10 Map Score: 4.79077 Number of sites scoring better than the average of aligned sites = 468 Number in coding regions = 431 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 3 CAAAACTAATTTAATTTGCAACTTTTAATCT 1 17 0 TTAATTTGAA 0.756056 -29 TTTTCCTTTTTACAAAAATTTA 2 2 1 TTTCCTTTTA 0.975696 -58 AGAGTTTTTATTACCTTTATAAGATATTAAA 2 29 0 TTACCTTTTA 0.961544 -31 TGTTTCTTTCTTTTTTAGTATTATTTT 4 7 1 TTTCTTTTTA 0.954188 -49 ATTTCTCTTCTTACCTGGATAGCATCTTTAC 5 35 1 TTACCTGGTA 0.930483 -199 GGATAGCATCTTTACTGGTTAAATGGATGCT 5 51 1 TTTACTGGTA 0.921276 -183 GAGCATGTTCTTTATTGTAAAGGTTCATAAG 5 80 0 TTTATTGTAA 0.814783 -154 CTATCAGTCTTTTCATTTCAAAATGGGCGGA 5 201 0 TTTCATTTAA 0.833826 -33 ******** ** Masking position 11 Map Score: 4.36672 Number of sites scoring better than the average of aligned sites = 634 Number in coding regions = 541 Number in noncoding regions = 93 Number of orfs with sites within 600 bp upstream = 97 Fraction of orfs with sites within 600 bp upstream = 0.0155798 Motif number 4 GAAATAGCTTGAAGAAATTTCAAC 3 4 0 GAAGAATTTC 0.97384 -67 AATCTTTTGCGGAGAAATAGCTTGAAGAAAT 3 17 0 GGAGAATAGC 0.985637 -54 AAGAGAAATGGAAGAATTTGCCAATTTATGG 5 13 0 GAAGAATTGC 0.994669 -221 CCTTTACAATAAAGAACATGCTCAAATACTC 5 88 1 AAAGAAATGC 0.924146 -146 ATAAATAATTGGAGTATTTGAGCATGTTCTT 5 99 0 GGAGTATTGA 0.929333 -135 ****** **** Masking position 6 Map Score: 1.69767 Number of sites scoring better than the average of aligned sites = 236 Number in coding regions = 222 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 5 AAATTTTTGTAAAAAGGAAAA 2 2 0 AAAAAGGAAA 0.941393 -58 AATAATACTAAAAAAGAAAGAAACA 4 6 0 AAAAAGAAAG 0.941393 -50 GGTAAGAAGAGAAATGGAAGAATTTGCCAA 5 20 0 GAAATGGAAG 0.989664 -214 CTTTACTGGTTAAATGGATGCTTATGAACC 5 60 1 TAAATGGATG 0.914304 -174 TTTTCATTTCAAAATGGGCGGAAAAACTAT 5 193 0 AAAATGGGCG 0.935936 -41 CGCCCATTTTGAAATGAAAAGACTGATAGG 5 203 1 GAAATGAAAA 0.916192 -31 ********** Masking position 4 Map Score: 2.23752 Number of sites scoring better than the average of aligned sites = 478 Number in coding regions = 429 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 6 AAAAGATTTATAATTCCTGGAACTATCAAC 3 40 1 TAATTCCTGG 0.97912 -31 CCATTTCTCTTCTTACCTGGATAGCATCTT 5 33 1 TCTTACCTGG 0.990626 -201 CTGGATAGCATCTTTACTGGTTAAATGGAT 5 49 1 TCTTTACTGG 0.979099 -185 TTCGGATTTCTCATGCCTGCATAGAGATTA 5 155 0 TCATGCCTGC 0.981045 -79 ********** Masking position 4 Map Score: 1.4481 Number of sites scoring better than the average of aligned sites = 100 Number in coding regions = 93 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 7 ********** No masking Map Score: -2.24942e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.24942e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -2.24942e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0