AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i322_mixed7_pyro_reg_100.orf -o322_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01018 214 Pyrococcus_OT3 Motif number 1 AGCGAAAAGTTGAACAAAATATCAA 1 4 0 TGACAAATAT 0.9986 -211 ATCCGTCTTATGTACAAAATATAACTGCAATT 1 71 1 TGACAAATAT 0.9986 -144 TTTTAGAATTTTGACTAAATATTATTGGATAT 1 102 1 TTACAAATAT 0.992734 -113 GCTTGAGAATTGGATAAAATATCCAATAATAT 1 120 0 TGATAAATAT 0.992735 -95 ATCTCCAAGTTGGACAAAATATCCAAGAGGTG 1 188 1 TGACAAATAT 0.9986 -27 ** ** ****** Masking position 7 Map Score: 14.4064 Number of sites scoring better than the average of aligned sites = 8 Number in coding regions = 5 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 2 TGATATTTTGTTCAACTTTTCGCTTTATTGATTT 1 12 1 TCACTTTGCT 0.995758 -203 TTGATTTACTTTCATCTATTTGATAATAATGTAT 1 39 1 TCACTTTGAT 0.982311 -176 AAAATATAACTGCAATTTTTAGAATTTTGACTAA 1 86 1 TCATTTTGAA 0.972941 -129 GGATATTTTGTCCAACTTGGAGATAGCAGATTCA 1 178 0 TCACTGGGAT 0.991122 -37 ACTTTCACCTCTTGGATATTTTGTCCA 1 198 0 TCACTTTGAT 0.998085 -17 * ** ** ** *** Masking position 7 Map Score: 6.36881 Number of sites scoring better than the average of aligned sites = 45 Number in coding regions = 40 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 AATTCTAAAAATTGCAGTTATATTTTGTAC 1 82 0 ATTGCAGTTA 0.923849 -133 ACTGCAATTTTTAGAATTTTGACTAAATAT 1 94 1 TTAGAATTTT 0.874779 -121 ACTAAATATTATTGGATATTTTATCCAATT 1 115 1 ATTGGATATT 0.975472 -100 TTCAAGGCTTTTAGGATTTATGGCATGAGG 1 152 0 TTAGGATTTA 0.937011 -63 CAACTTGGAGATAGCAGATTCAAGGCTTTT 1 170 0 ATAGCAGATT 0.95769 -45 ACTTTCACCTCTTGGATATTTTGTCCAACT 1 195 0 CTTGGATATT 0.958896 -20 ********** Masking position 6 Map Score: 2.453 Number of sites scoring better than the average of aligned sites = 385 Number in coding regions = 353 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 4 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.32571e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0