AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i322_mixed7_pyro_reg_300.orf -o322_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01018 214 Pyrococcus_OT3 #2 RPH01015 36 Pyrococcus_OT3 #3 RPH01014 181 Pyrococcus_OT3 Motif number 1 AGCGAAAAGTTGAACAAAATATCAA 1 4 0 TGACAAATAT 0.996905 -211 ATCCGTCTTATGTACAAAATATAACTGCAATT 1 71 1 TGACAAATAT 0.996905 -144 TTTTAGAATTTTGACTAAATATTATTGGATAT 1 102 1 TTACAAATAT 0.988748 -113 GCTTGAGAATTGGATAAAATATCCAATAATAT 1 120 0 TGATAAATAT 0.976626 -95 ATCTCCAAGTTGGACAAAATATCCAAGAGGTG 1 188 1 TGACAAATAT 0.996905 -27 AGATCCCTTATGCCCTAAATCTTTATTTATTT 3 146 0 TGCCAAATCT 0.968252 -36 GGATGGTTCACCAAAGATCCCTTATGCC 3 164 0 TTACAAAGAT 0.964335 -18 ** ** ****** Masking position 7 Map Score: 14.7754 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 13 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 2 TTATGGCATGAGGGCTTGAGAATTGGATAA 1 135 0 AGGGCTTGAG 0.98792 -80 TCAAGCCCTCATGCCATAAATCCTAAAAGC 1 146 1 ATGCCATAAA 0.898831 -69 TAAATCCTAAAAGCCTTGAATCTGCTATCT 1 162 1 AAGCCTTGAA 0.934609 -53 TTTATCTGGGAGGGCGTTAAA 2 26 1 AGGGCGTTAA 0.969363 -11 CCCACCACAAAGGGCTTAAATTTACCAATT 3 15 1 AGGGCTTAAA 0.990162 -167 TAATGTAAATTAGGCATTAGTTTTGTTTTC 3 100 1 TAGGCATTAG 0.856599 -82 TTTGTTTTCAAAGGCAAAAACAGAAAAATA 3 121 1 AAGGCAAAAA 0.919164 -61 ATAAAGATTTAGGGCATAAGGGATCTTTGG 3 152 1 AGGGCATAAG 0.992275 -30 ********** Masking position 9 Map Score: 7.70047 Number of sites scoring better than the average of aligned sites = 431 Number in coding regions = 396 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 3 AGATGAAAGTAAATCAATAAAGCGAAAAGT 1 26 0 AAATCAATAA 0.867132 -189 CATTATTATCAAATAGATGAAAGTAAATCA 1 40 0 AAATAGATGA 0.945162 -175 TCCAACTTGGAGATAGCAGATTCAAGGCTT 1 172 0 AGATAGCAGA 0.933362 -43 GATAAAAAAGAAATAGAGAAA 2 2 0 AAATAGAGAA 0.937598 -35 ACGCCCTCCCAGATAAAAAAGAAATAGAGA 2 13 0 AGATAAAAAA 0.962427 -24 CATTAAAAACAGATAACAAAGCTAACATAA 3 75 0 AGATAACAAA 0.945165 -107 AAAAACAGAAAAATAAATAAAGATTTAGGG 3 136 1 AAATAAATAA 0.954978 -46 ********** Masking position 3 Map Score: 4.11662 Number of sites scoring better than the average of aligned sites = 385 Number in coding regions = 343 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 4 AAAATTCTAAAAATTGCAGTTATATTTTGTACAT 1 80 0 AATTCATTTA 0.981655 -135 AATTGGATAAAATATCCAATAATATTTAGTCAAA 1 111 0 AAATCATATA 0.981655 -104 GAATTTTAGGAAGATACATTTTTAATTGGTAAAT 3 34 0 AAATCATTTA 0.987121 -148 GTATCTTCCTAAAATTCAAATCTATTATGTTAGC 3 51 1 AAATCAATTA 0.958709 -131 ACTAATGCCTAATTTACATTAAAAACAGATAACA 3 87 0 AATTCATAAA 0.919062 -95 ** ** ** ** ** Masking position 8 Map Score: 0.673663 Number of sites scoring better than the average of aligned sites = 36 Number in coding regions = 27 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 5 ********** No masking Map Score: 7.76924e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.76924e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.76924e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0