AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i323_mixed8_pyro_reg_100.orf -o323_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH01201 239 Pyrococcus_OT3 Motif number 1 CCCCCGCTATGGCCGCCGTACCACTAACCACTCCCCAC 1 18 0 GGCGCCACAC 0.985011 -222 CCATAGCGGGGGGGTTACACCCGGTCTCATTTCGAACC 1 44 1 GGGCCCGGTC 0.999683 -196 ATCGCTGGGGGGCTTAACTTCCGGGTTCGAAATGAGAC 1 67 0 GGCCCCGGTC 0.999841 -173 CCTCTCGGAGGGCAGTACAACCGGGATCGCTGGGGGGC 1 92 0 GGCCCCGGTC 0.999828 -148 CGGCGTCCCCGGCTTCCCGCCCCCTCTCGGAGGGCAGT 1 114 0 GGCCCCCCTC 0.998863 -126 GCGGGAAGCCGGGGACGCCGCCGGCCACCCTAATTCTC 1 132 1 GGGCCCGGAC 0.997122 -108 *** * **** ** Masking position 11 Map Score: 15.3311 Number of sites scoring better than the average of aligned sites = 20 Number in coding regions = 12 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 AGTGTTTGTGGGGAGTGGTTAGTGG 1 5 1 TTTGGGGGAG 0.961952 -235 ACGGCGGCCATAGCGGGGGGGTTACACCCGG 1 37 1 TAGCGGGGGG 0.998698 -203 ACAACCGGGATCGCTGGGGGGCTTAACTTCC 1 83 0 TCGCGGGGGG 0.998419 -157 CCGCCCCCTCTCGGAGGGCAGTACAACCGGG 1 105 0 TCGGGGGCAG 0.995535 -135 TGCCCTCCGAGAGGGGGCGGGAAGCCGGGGA 1 116 1 GAGGGGCGGG 0.986087 -124 AGGGGGCGGGAAGCCGGGGACGCCGCCGGCC 1 127 1 AAGCGGGGAC 0.958543 -113 TCAAGAGAATTAGGGTGGCCGGCGGCGTCCC 1 143 0 TAGGTGGCCG 0.953679 -97 **** ****** Masking position 7 Map Score: 8.07155 Number of sites scoring better than the average of aligned sites = 277 Number in coding regions = 238 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 3 AAAAACTTTACAAATTTAAAGAATTTGGAC 1 181 0 CAAATTTAAA 0.938568 -59 TTTTATAGGGCAAATATTCAACACATAAAC 1 207 1 CAAATATTCA 0.982962 -33 AAATATTCAACACATAAACAGGTGAAAATG 1 218 1 CACATAAACA 0.973797 -22 CACATTTTCACCTGTTTATG 1 230 0 CACATTTTCA 0.989455 -10 ********** Masking position 5 Map Score: 2.22219 Number of sites scoring better than the average of aligned sites = 65 Number in coding regions = 52 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 4 GTTAGTGGTACGGCGGCCATAGCGGGGGGG 1 28 1 CGGCGGCCAT 0.993506 -212 GCGGCCATAGCGGGGGGGTTACACCCGGTC 1 40 1 CGGGGGGGTT 0.964067 -200 GCTTAACTTCCGGGTTCGAAATGAGACCGG 1 64 0 CGGGTTCGAA 0.93225 -176 GCAGTACAACCGGGATCGCTGGGGGGCTTA 1 89 0 CGGGATCGCT 0.947607 -151 CGCCCCCTCTCGGAGGGCAGTACAACCGGG 1 105 0 CGGAGGGCAG 0.943517 -135 GCGGCGTCCCCGGCTTCCCGCCCCCTCTCG 1 123 0 CGGCTTCCCG 0.527762 -117 GGGACGCCGCCGGCCACCCTAATTCTCTTG 1 143 1 CGGCCACCCT 0.618449 -97 ********** Masking position 3 Map Score: 3.76068 Number of sites scoring better than the average of aligned sites = 228 Number in coding regions = 184 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 5 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0