AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i324_mixed9_pyro_reg_100.orf -o324_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00371 136 Pyrococcus_OT3 Motif number 1 CCTTAAAGATTTATACTAATGTTCTATTAT 1 42 1 TTATACTAAT 0.995638 -95 TAATGTTCTATTATATAAATTTTGCTATCT 1 58 1 TTATATAAAT 0.945159 -79 TAAATATATTTGATACTAAGATAGCAAAAT 1 76 0 TGATACTAAG 0.978869 -61 TTATACGACTTTATACTATTTAAATATATT 1 96 0 TTATACTATT 0.989053 -41 CTTAGATAGATTATACGACTTTATACTATT 1 106 0 TTATACGACT 0.987428 -31 ********** Masking position 5 Map Score: 6.77743 Number of sites scoring better than the average of aligned sites = 35 Number in coding regions = 29 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 2 CACCTCATGACTATGGATGGGAGATCCTTA 1 17 1 CTATGGATGG 0.990536 -120 GTATAAATCTTTAAGGATCTCCCATCCATA 1 28 0 TTAAGGATCT 0.982778 -109 AAGATTTATACTAATGTTCTATTATATAAA 1 47 1 CTAATGTTCT 0.957477 -90 TATAATCTATCTAAGGAGGGAGCAGC 1 121 1 CTAAGGAGGG 0.995097 -16 ********** Masking position 3 Map Score: 2.17182 Number of sites scoring better than the average of aligned sites = 254 Number in coding regions = 246 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 3 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0