AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i329_not_clear4_pyro_reg_100.orf -o329_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00798 50 Pyrococcus_OT3 #2 RPH00797 116 Pyrococcus_OT3 Motif number 1 TTAACTTCCTTCATTGGATAATTTCTCCAG 1 22 1 TCATTGGATA 0.99648 -29 TTTTCATCACTGGAGAAATTATCCAA 1 35 0 TCACTGGAGA 0.992396 -16 CTTAACAAATTCATTGGAACTGGGAGTGGG 2 20 0 TCATTGGAAC 0.980666 -97 GTTAAGTTCCTTACGGGATAAAATATCCAT 2 44 1 TTACGGGATA 0.971792 -73 AAATATTGTTTCATAGAATAGAATCCCAGG 2 87 1 TCATAGAATA 0.9557 -30 ********** Masking position 3 Map Score: 5.82137 Number of sites scoring better than the average of aligned sites = 141 Number in coding regions = 131 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 2 TATCCAATGAAGGAAGTTAAAAAGATAAGGG 1 9 0 AGAATAAAAA 0.980764 -42 TCATCACTGGAGAAATTATCCAATGAAGGAAGT 1 25 0 AGAATTCCAA 0.996085 -26 TTATCCCGTAAGGAACTTAACAAATTCATTGGA 2 32 0 AGAATAACAA 0.991368 -85 TCCTTACGGGATAAAATATCCATACTAGCAACT 2 51 1 ATAATTCCAT 0.935807 -66 TATCCATACTAGCAACTCTTAAATATTGTTTCA 2 67 1 AGAATTTAAA 0.976374 -50 ** ** * ***** Masking position 7 Map Score: 2.24529 Number of sites scoring better than the average of aligned sites = 166 Number in coding regions = 143 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 3 TCATTGGATAATTTCTCCAGTGATGAAAA 1 32 1 ATTTCTCCAG 0.987496 -19 AGTATGGATATTTTATCCCGTAAGGAACTT 2 47 0 TTTTATCCCG 0.992866 -70 TTTTCTCACCCCTGGGATTC 2 107 0 TTTTCTCACC 0.986958 -10 ********** Masking position 6 Map Score: 0.435699 Number of sites scoring better than the average of aligned sites = 96 Number in coding regions = 90 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0