AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i329_not_clear4_pyro_reg_300.orf -o329_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00798 50 Pyrococcus_OT3 #2 RPH00797 116 Pyrococcus_OT3 Motif number 1 CTGGAGAAATTATCCAATGAAGGAAGTTAA 1 22 0 TATCCAATGA 0.997381 -29 TTGGATAATTTCTCCAGTGATGAAAA 1 35 1 TCTCCAGTGA 0.993092 -16 CCCACTCCCAGTTCCAATGAATTTGTTAAG 2 20 1 GTTCCAATGA 0.985616 -97 ATGGATATTTTATCCCGTAAGGAACTTAAC 2 44 0 TATCCCGTAA 0.978931 -73 CCTGGGATTCTATTCTATGAAACAATATTT 2 87 0 TATTCTATGA 0.966822 -30 ********** Masking position 3 Map Score: 5.82137 Number of sites scoring better than the average of aligned sites = 141 Number in coding regions = 131 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 2 AGAAATTATCCAATGAAGGAAGTTAAAAAG 1 18 0 CAATGAAGGA 0.948706 -33 GATAATTTCTCCAGTGATGAAAA 1 38 1 CCAGTGATGA 0.993607 -13 GATATTTTATCCCGTAAGGAACTTAACAAA 2 41 0 CCCGTAAGGA 0.987764 -76 TTAAGAGTTGCTAGTATGGATATTTTATCC 2 59 0 CTAGTATGGA 0.972546 -58 GAATAGAATCCCAGGGGTGAGAAAA 2 102 1 CCAGGGGTGA 0.990812 -15 ********** Masking position 10 Map Score: 3.84955 Number of sites scoring better than the average of aligned sites = 517 Number in coding regions = 485 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 3 TTTTTAACTTCCTTCATTGGATAATTTCTC 1 19 1 CCTTCATTGG 0.995769 -32 TTTTCATCACTGGAGAAATTATC 1 38 0 TCATCACTGG 0.989952 -13 GAACTTAACAAATTCATTGGAACTGGGAGT 2 23 0 AATTCATTGG 0.987977 -94 ********** Masking position 6 Map Score: 1.48185 Number of sites scoring better than the average of aligned sites = 72 Number in coding regions = 68 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0