AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i344_weak5_pyro_reg_100.orf -o344_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00650 110 Pyrococcus_OT3 #2 RPH00649 27 Pyrococcus_OT3 #3 RPH01152 38 Pyrococcus_OT3 #4 RPH01153 136 Pyrococcus_OT3 Motif number 1 ATGGAAATCCGGAATTTATCTAAGTTAAGCA 1 16 1 GGAATTATCT 0.944174 -95 GCTTAATGAAGGTATCAATCCTAACACCTAA 1 59 1 GGTATAATCC 0.979448 -52 GTTATCTTTATTATTCTTTTTTTTAAT 3 7 1 TTTATATTCT 0.78223 -32 TTAAAACCTAGGTATTAACTTTTACCGATGG 4 18 0 GGTATAACTT 0.90209 -119 AGGTTTTAAAGGTATGGATCTAATATCGTTG 4 40 1 GGTATGATCT 0.985696 -97 CGTTGAACGTTGTATCAATGTTCGTTAATCA 4 69 0 TGTATAATGT 0.973673 -68 CAACGAGAAGTTTATAAATCCTTAGGGGAAT 4 95 1 TTTATAATCC 0.919006 -42 AATCCTTAGGGGAATAAATGTATAAGGTGAC 4 111 1 GGAATAATGT 0.971601 -26 ***** ***** Masking position 4 Map Score: 5.80061 Number of sites scoring better than the average of aligned sites = 266 Number in coding regions = 238 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 2 CGTATTTCTGCTTAACTTAGATAAATTCCG 1 25 0 CTTAACTTAG 0.960417 -86 GGATTGATACCTTCATTAAGCTCACCGTAT 1 50 0 CTTCATTAAG 0.591887 -61 CCTAATTTTTCTTCAAATTGCCTTGGGAGA 1 85 1 CTTCAAATTG 0.960359 -26 CCCCCTTGCTCTTCACTTTG 2 1 0 CTTCACTTTG 0.995583 -27 GATTTATAAACTTCTCGTTGAACGTTGTAT 4 85 0 CTTCTCGTTG 0.975823 -52 ********** Masking position 3 Map Score: 3.48062 Number of sites scoring better than the average of aligned sites = 184 Number in coding regions = 168 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 3 GCAGAAATACGGTGAGCTTAATGAAGGTAT 1 44 1 GGTGAGCTTA 0.994743 -67 AATTGCCTTGGGAGAGCATAC 1 100 1 GGAGAGCATA 0.994743 -11 AAATGTATAAGGTGACAATAC 4 126 1 GGTGACAATA 0.985307 -11 ********** Masking position 5 Map Score: 1.37563 Number of sites scoring better than the average of aligned sites = 26 Number in coding regions = 24 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 AGTTAAGCAGAAATACGGTGAGCTTAATGA 1 38 1 AAATACGGTG 0.991086 -73 ATTTGAAGAAAAATTAGGTGTTAGGATTGA 1 73 0 AAATTAGGTG 0.986828 -38 GGGAATAAATGTATAAGGTGACAATAC 4 120 1 GTATAAGGTG 0.984389 -17 ********** Masking position 3 Map Score: 0.588679 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 11 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 TGAAGAAAAATTAGGTGTTAGGATTGATAC 1 70 0 TTAGGTGTTA 0.982966 -41 AAGTGAAGAGCAAGGGGGTAGTAGG 2 13 1 CAAGGGGGTA 0.968545 -15 AAGTTAATACCTAGGTTTTAAAGGTATGGA 4 28 1 CTAGGTTTTA 0.965179 -109 TTTATTCCCCTAAGGATTTATAAACTTCTC 4 99 0 TAAGGATTTA 0.935164 -38 AATAAATGTATAAGGTGACAATAC 4 123 1 TAAGGTGACA 0.936629 -14 ********** Masking position 3 Map Score: 0.737956 Number of sites scoring better than the average of aligned sites = 218 Number in coding regions = 197 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 6 ********** No masking Map Score: -2.53363e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.53363e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.53363e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0