AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i347_weak8_pyro_reg_100.orf -o347_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00141 201 Pyrococcus_OT3 Motif number 1 ATTACCTGTAGGGTCCCGCGGTAGCCTAGCC 1 88 1 GGGTCCGCGG 0.999789 -114 AGCCTAGCCTGGGAGTGGCGGCGGACTGTAG 1 110 1 GGGAGTGCGG 0.997783 -92 ATTTGAACCGGGGACCTGCGGATCTACAGTC 1 133 0 GGGACCGCGG 0.999792 -69 AGAATTCTGGTGGTCCCGCGGCCCGGATTTG 1 159 0 TGGTCCGCGG 0.999172 -43 ****** **** Masking position 8 Map Score: 11.9796 Number of sites scoring better than the average of aligned sites = 4 Number in coding regions = 3 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 TAAAGTTTTCGCGAGGAGTTTTAAACAAGG 1 28 0 GCGAGGAGTT 0.921132 -174 GCTAGGCTACCGCGGGACCCTACAGGTAAT 1 88 0 CGCGGGACCC 0.993254 -114 GGTAGCCTAGCCTGGGAGTGGCGGCGGACT 1 107 1 CCTGGGAGTG 0.975153 -95 CTGGGAGTGGCGGCGGACTGTAGATCCGCA 1 118 1 CGGCGGACTG 0.991625 -84 CGGATTTGAACCGGGGACCTGCGGATCTAC 1 137 0 CCGGGGACCT 0.997012 -65 TGGTCCCGCGGCCCGGATTTGAACCGGGGA 1 150 0 GCCCGGATTT 0.921132 -52 AAATCCGGGCCGCGGGACCACCAGAATTCT 1 160 1 CGCGGGACCA 0.990146 -42 ********** Masking position 7 Map Score: 6.81948 Number of sites scoring better than the average of aligned sites = 231 Number in coding regions = 191 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 3 TTAAACAAGGATAGCGAAATTTGCTTT 1 8 0 ATAGCGAAAT 0.97331 -194 TTTAAAACTCCTCGCGAAAACTTTATAAAC 1 33 1 CTCGCGAAAA 0.990716 -169 CCAAAATCATCTCACTAAATGTGGGTTTAT 1 57 0 CTCACTAAAT 0.973294 -145 CCTACAGGTAATCCCAAAATCATCTCACTA 1 70 0 ATCCCAAAAT 0.971974 -132 ********** Masking position 7 Map Score: 0.879554 Number of sites scoring better than the average of aligned sites = 66 Number in coding regions = 63 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0