AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i347_weak8_pyro_reg_300.orf -o347_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00141 201 Pyrococcus_OT3 Motif number 1 GGCTAGGCTACCGCGGGACCCTACAGGTAAT 1 88 0 CCGCGGACCC 0.999816 -114 CTACAGTCCGCCGCCACTCCCAGGCTAGGCT 1 110 0 CCGCACTCCC 0.99808 -92 GACTGTAGATCCGCAGGTCCCCGGTTCAAAT 1 133 1 CCGCGGTCCC 0.99982 -69 CAAATCCGGGCCGCGGGACCACCAGAATTCT 1 159 1 CCGCGGACCA 0.999283 -43 **** ****** Masking position 4 Map Score: 11.9796 Number of sites scoring better than the average of aligned sites = 4 Number in coding regions = 3 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 CCTTGTTTAAAACTCCTCGCGAAAACTTTA 1 28 1 AACTCCTCGC 0.922326 -174 ATTACCTGTAGGGTCCCGCGGTAGCCTAGC 1 88 1 GGGTCCCGCG 0.993362 -114 AGTCCGCCGCCACTCCCAGGCTAGGCTACC 1 107 0 CACTCCCAGG 0.97555 -95 TGCGGATCTACAGTCCGCCGCCACTCCCAG 1 118 0 CAGTCCGCCG 0.991761 -84 GTAGATCCGCAGGTCCCCGGTTCAAATCCG 1 137 1 AGGTCCCCGG 0.997061 -65 TCCCCGGTTCAAATCCGGGCCGCGGGACCA 1 150 1 AAATCCGGGC 0.922326 -52 AGAATTCTGGTGGTCCCGCGGCCCGGATTT 1 160 0 TGGTCCCGCG 0.990306 -42 ********** Masking position 4 Map Score: 6.81948 Number of sites scoring better than the average of aligned sites = 231 Number in coding regions = 191 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 3 TTAAACAAGGATAGCGAAATTTGCTTT 1 8 0 ATAGCGAAAT 0.973128 -194 TTTAAAACTCCTCGCGAAAACTTTATAAAC 1 33 1 CTCGCGAAAA 0.990619 -169 CCAAAATCATCTCACTAAATGTGGGTTTAT 1 57 0 CTCACTAAAT 0.973018 -145 CCTACAGGTAATCCCAAAATCATCTCACTA 1 70 0 ATCCCAAAAT 0.971689 -132 ********** Masking position 7 Map Score: 0.879554 Number of sites scoring better than the average of aligned sites = 66 Number in coding regions = 63 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0