AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i002_Purine_Nucleotides_Metabolism_mthe_reg_300.orf -o002_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01986 43 M.thermo #2 RTH02089 56 M.thermo Motif number 1 GCTATAAAAAATGATTTATTC 1 1 1 GCTATAAAAA 0.997895 -43 TATATGGGGTGCTATGAATAAATCATTTTTT 1 16 0 GCTATAATAA 0.994809 -28 CCAGGATCAAAAAACTCGAGCGA 2 3 1 AGGATAAAAA 0.985991 -54 AAAAACTCGAGCGATGAAAAACCGAATGGAT 2 20 1 GCGATAAAAA 0.998664 -37 ***** ***** Masking position 5 Map Score: 7.65418 Number of sites scoring better than the average of aligned sites = 25 Number in coding regions = 19 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 2 GCTATAAAAAATGATTTATTCATA 1 5 1 TAAAAAATGA 0.95866 -39 AGCGATGAAAAACCGAATGGATATGATGTA 2 29 1 AACCGAATGG 0.995565 -28 GGATATGATGTACAGAATGG 2 47 1 TACAGAATGG 0.997881 -10 ********** Masking position 6 Map Score: 2.00368 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 42 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 3 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0