AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i014_Glycolysis_1_mthe_reg_100.orf -o014_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01963 195 M.thermo Motif number 1 AATTTAATTTTTCACTGGTTTAACATCATC 1 23 1 TTCACTGGTT 0.945252 -173 CCCCACATAGTGAAGGTGTTAAATGCAGAA 1 61 0 TGAAGGTGTT 0.969736 -135 TATGTGGGGATGCGCTGGATATTACAGGCA 1 82 1 TGCGCTGGAT 0.983249 -114 CGGGAGTTGTTGAAGGGGTTCATGAATGAA 1 114 0 TGAAGGGGTT 0.995195 -82 GTGACATCCGTGCGGGAGTTGTTGAAGGGG 1 126 0 TGCGGGAGTT 0.979048 -70 ATAGTATGGTTGAGGTGTATTATAAAATAT 1 159 0 TGAGGTGTAT 0.923453 -37 GATTAATGGGATATCTCATAGT 1 184 0 TTAATGGGAT 0.892645 -12 ********** Masking position 1 Map Score: 6.44541 Number of sites scoring better than the average of aligned sites = 2029 Number in coding regions = 1889 Number in noncoding regions = 140 Number of orfs with sites within 600 bp upstream = 125 Fraction of orfs with sites within 600 bp upstream = 0.0200771 Motif number 2 ATAGTGAAGGTGTTAAATGCAGAAAGCTGT 1 55 0 TGTTAAATGC 0.959328 -141 TGAATTTGCCTGTAATATCCAGCGCATCCC 1 88 0 TGTAATATCC 0.993075 -108 TAAAATATGCTGTGACATCCGTGCGGGAGT 1 137 0 TGTGACATCC 0.99283 -59 AGGTGTATTATAAAATATGCTGTGACATCC 1 147 0 TAAAATATGC 0.933585 -49 AACCATACTATGAGATATCCCATTAATC 1 178 1 TGAGATATCC 0.986583 -18 ********** Masking position 5 Map Score: 5.6949 Number of sites scoring better than the average of aligned sites = 147 Number in coding regions = 130 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 3 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0