AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i034_Pyruvate_Synthase_2_mthe_reg_100.orf -o034_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00913 86 M.thermo Motif number 1 ACTAAAATTAATGGGGGTAACGAA 1 5 0 ATGGGGGTAA 0.99897 -82 ATATATATACATGTTGGTCAACTAAAATTA 1 25 0 ATGTTGGTCA 0.995074 -62 ACAATGAGAAATGGAGGTAAACT 1 74 1 ATGGAGGTAA 0.998475 -13 ********** Masking position 1 Map Score: 5.62175 Number of sites scoring better than the average of aligned sites = 46 Number in coding regions = 40 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 2 CTAAAATTAATGGGGGTAACGAA 1 4 0 TGGGGGTAAC 0.998143 -83 TATATATACATGTTGGTCAACTAAAATTAA 1 24 0 TGTTGGTCAA 0.991827 -63 CAATGAGAAATGGAGGTAAACT 1 75 1 TGGAGGTAAA 0.995072 -12 ********** Masking position 9 Map Score: 3.61332 Number of sites scoring better than the average of aligned sites = 96 Number in coding regions = 88 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 3 TTACCCCCATTAATTTTAGTTGACCAACAT 1 15 1 TAATTTTAGT 0.971987 -72 TAATATATATACATGTTGGTCAACTAAAAT 1 27 0 ACATGTTGGT 0.970185 -60 AATCATTATAAATTTTTAATATATATACAT 1 43 0 AATTTTTAAT 0.975319 -44 CTCCATTTCTCATTGTTAATCATTATAAAT 1 60 0 CATTGTTAAT 0.980925 -27 ********** Masking position 6 Map Score: 0.821506 Number of sites scoring better than the average of aligned sites = 53 Number in coding regions = 29 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 4 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0