AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i035_Sugars_Metabolism_mthe_reg_100.orf -o035_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01371 145 M.thermo #2 RTH00133 56 M.thermo #3 RTH01743 127 M.thermo Motif number 1 TATTATCAAGTTATTAAAGGGCCAGAT 1 1 0 TTATAGGAGT 0.980395 -145 ATCAGTATCGTCATATAAGATATAGATATTATCAAGT 1 27 0 TCATAGAAGT 0.876975 -119 GATATATAAAATAATCAGAGGTGTGTTTCTGGGCTAT 1 61 1 ATAAAAGTGT 0.903419 -85 CTTTCCTCCATGAATCTGTTAAAATGATAT 1 126 0 TCCTAGATGT 0.91913 -20 GGAGAAAAAAATCAGTAGGGGTGAGGTGGTGGAGGGG 2 12 0 ATCAAGGAGT 0.979701 -45 ACATATATGTACATCAAAGGGAATGGTTAATAAACA 3 10 0 ACATAGGTGT 0.983695 -118 TGATGTACATATATGTACAGTAAAGTTTTAAATAGTT 3 31 1 ATATAAGAGT 0.941531 -97 GCAGTAAGATATCTTTAAAGAACTATTTAAAACTTTA 3 51 0 ATCTAAGTAT 0.742149 -77 AAAGATATCTTACTGCATGGAAATGATGATTTCATCA 3 72 1 TACTAGGTGT 0.942837 -56 TGATGATTTCATCAGTAGGGACCAGTTCCAGCCATGA 3 95 1 ATCAAGGAGT 0.980999 -33 **** * ** ** * Masking position 7 Map Score: 7.16962 Number of sites scoring better than the average of aligned sites = 1158 Number in coding regions = 1067 Number in noncoding regions = 91 Number of orfs with sites within 600 bp upstream = 85 Fraction of orfs with sites within 600 bp upstream = 0.0136524 Motif number 2 TAATAACTTGATAATATCTATATCTTATATG 1 22 1 ATATATCTAT 0.899147 -124 CTGATTATTTTATATATCAGTATCGTCATAT 1 48 0 TAATATCAGT 0.979602 -98 GGGCTATATTTAAATATCTATGTTATCATAA 1 91 1 TAATATCTAT 0.965223 -55 TTATCATAATACTATATCATTTTAACAGATT 1 113 1 ACATATCATT 0.910273 -33 CTCCGGGAGAAAAAAATCAGTAGGGGTGAGG 2 23 0 AAAAATCAGT 0.928342 -34 CCCTTTGATGTACATATATGTACAGTAAAGT 3 26 1 TAATATATGT 0.890247 -102 TCCATGCAGTAAGATATCTTTAAAGAACTAT 3 62 0 AAATATCTTT 0.973073 -66 ** ******** Masking position 6 Map Score: 4.09012 Number of sites scoring better than the average of aligned sites = 137 Number in coding regions = 107 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 47 Fraction of orfs with sites within 600 bp upstream = 0.00754899 Motif number 3 CATGAATCTGTTAAAATGATATAGTATTAT 1 118 0 TTAAAATGAT 0.878598 -28 TGTACATCAAAGGGAATGGTTAATAAACA 3 10 0 AGGGAATGGT 0.976206 -118 TCTTACTGCATGGAAATGATGATTTCATCA 3 79 1 TGGAAATGAT 0.991322 -49 ACCTCATGGCTGGAACTGGTCCCTACTGAT 3 105 0 TGGAACTGGT 0.990445 -23 ********** Masking position 5 Map Score: 0.70601 Number of sites scoring better than the average of aligned sites = 119 Number in coding regions = 102 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0