AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i038_Galactose_Metabolism__mthe_reg_100.orf -o038_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00414 143 M.thermo Motif number 1 TATATGAAATCAGACCATTAAAGCTATGCAAA 1 29 1 CAGCCATAAA 0.997708 -115 TATGCAAAGGCAGACCACAAAGACCTACCCAC 1 53 1 CAGCCACAAG 0.999014 -91 CCACAAAGACCTACCCACAAAAACAGGCCACC 1 67 1 CTACCACAAA 0.994229 -77 CCCACAAAAACAGGCCACCAAACCTTATTTAC 1 80 1 CAGCCACAAA 0.999422 -64 *** **** *** Masking position 7 Map Score: 7.82285 Number of sites scoring better than the average of aligned sites = 6 Number in coding regions = 2 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 GATTAATATATGAAATCAGACCATTAAAGCTA 1 23 1 TGAACAGACC 0.990319 -121 TAAAGCTATGCAAAGGCAGACCACAAAGACCT 1 47 1 CAAACAGACC 0.999147 -97 AGGCAGACCACAAAGACCTACCCACAAAAACA 1 60 1 CAAACCTACC 0.995791 -84 GACCTACCCACAAAAACAGGCCACCAAACCTT 1 74 1 CAAACAGGCC 0.99813 -70 GAAATATAGACAGAATCATATCTGTGTGATAA 1 121 1 CAGACATATC 0.978447 -23 **** ****** Masking position 4 Map Score: 6.90825 Number of sites scoring better than the average of aligned sites = 95 Number in coding regions = 84 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0