AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i039_Mannose_Metabolism_mthe_reg_100.orf -o039_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00811 112 M.thermo Motif number 1 CTTTATTCATTGAGGTAATG 1 1 1 CTTTATTCAT 0.979074 -112 CCGTATGAATTTTTAATCACATTACCTCAA 1 20 0 TTTTAATCAC 0.98877 -93 GAAGGTCTGACTTTATCCATATTGGTGATT 1 53 1 CTTTATCCAT 0.980573 -60 ATATTTGAATTGTTAATCACCAATATGGAT 1 67 0 TGTTAATCAC 0.975417 -46 ACAATTCAAATATTATCCAGTGAATGGGGC 1 84 1 TATTATCCAG 0.966546 -29 TTTTTAACAGCCCCATTCAC 1 103 0 TTTTTAACAG 0.894999 -10 ********** Masking position 4 Map Score: 6.35146 Number of sites scoring better than the average of aligned sites = 161 Number in coding regions = 109 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 2 TTTATTCATTGAGGTAATGTGATTAAAAAT 1 12 1 GAGGTAATGT 0.991876 -101 AATTCATACGGAGTGAAGGTCTGACTTTAT 1 39 1 GAGTGAAGGT 0.997002 -74 AAATATTATCCAGTGAATGGGGCTGTTAAA 1 91 1 CAGTGAATGG 0.994233 -22 ********** Masking position 6 Map Score: 1.6458 Number of sites scoring better than the average of aligned sites = 70 Number in coding regions = 64 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 ATCACATTACCTCAATGAATAAAG 1 5 0 CTCAATGAAT 0.986697 -108 GACCTTCACTCCGTATGAATTTTTAATCAC 1 30 0 CCGTATGAAT 0.989103 -83 TGTTAATCACCAATATGGATAAAGTCAGAC 1 57 0 CAATATGGAT 0.946895 -56 TCACTGGATAATATTTGAATTGTTAATCAC 1 77 0 ATATTTGAAT 0.874271 -36 TCAAATATTATCCAGTGAATGGGGCTGTTA 1 89 1 TCCAGTGAAT 0.945096 -24 ********** Masking position 6 Map Score: 0.55827 Number of sites scoring better than the average of aligned sites = 429 Number in coding regions = 391 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0