AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i059_Sulfate_trans-cys_synthase_mthe_reg_100.orf -o059_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00068 49 M.thermo #2 RTH00701 136 M.thermo Motif number 1 GACCCCGACTTTTTCTGAAG 1 40 1 TTTTCTGAAG 0.991095 -10 GTTCTGGGAATAACTCCCTCA 2 2 1 TTCTGGGAAT 0.971832 -135 AAAGAAGGACTACTCTGAGGGAGTTATTCC 2 17 0 TACTCTGAGG 0.990775 -120 TACATATCGGTTCTGTGAAGGAATGAGAAC 2 67 0 TTCTGTGAAG 0.994239 -70 TCGATATAGGTGTTCTGAGTTAATGGAGGT 2 109 1 TGTTCTGAGT 0.969094 -28 ********** Masking position 4 Map Score: 5.08777 Number of sites scoring better than the average of aligned sites = 325 Number in coding regions = 290 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 2 GGGTCTTAAAAATAAAGTAGTATGTTAACT 1 15 0 AATAAAGTAG 0.955378 -35 CTTCAGAAAAAGTCGGGGTCTTAAA 1 35 0 GAAAAAGTCG 0.973585 -15 CGTCCTGAAAGATAAAGAAGGACTACTCTG 2 30 0 GATAAAGAAG 0.992804 -107 TGTCCATGTCGATATAGGTGTTCTGAGTTA 2 101 1 GATATAGGTG 0.954333 -36 GGTGTTCTGAGTTAATGGAGGTTAAAGACC 2 117 1 GTTAATGGAG 0.965865 -20 GTTAATGGAGGTTAAAGACC 2 127 1 GTTAAAGACC 0.948149 -10 ********** Masking position 4 Map Score: 4.44482 Number of sites scoring better than the average of aligned sites = 483 Number in coding regions = 437 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 3 AGAACATGGGATCGTCCTGAAAGATAAAGAA 2 41 0 ATCGTCCTGA 0.993636 -96 CCTTCACAGAACCGATATGTATATATGTCCA 2 76 1 ACCGATATGA 0.99047 -61 GAACACCTATATCGACATGGACATATATACA 2 93 0 ATCGACATGA 0.996957 -44 ********* * Masking position 1 Map Score: 0.381094 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 16 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 CTTCAGAAAAAGTCGGGGTCTTAAA 1 35 0 GAAAAAGTCG 0.957742 -15 GTTCTGGGAATAACTCCCTCAGAGTAG 2 8 1 GAATAACTCC 0.990287 -129 GAAAGATAAAGAAGGACTACTCTGAGGGAG 2 24 0 GAAGGACTAC 0.983711 -113 TTCTGTGAAGGAATGAGAACATGGGATCGT 2 57 0 GAATGAGAAC 0.976955 -80 ********** Masking position 6 Map Score: 0.364728 Number of sites scoring better than the average of aligned sites = 147 Number in coding regions = 138 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 5 ********** No masking Map Score: 4.57179e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 4.57179e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 4.57179e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0