AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i061_Glutamate_Synthase_mthe_reg_100.orf -o061_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00475 137 M.thermo Motif number 1 TTACAATTCTCATTTAATGATAAAATATT 1 8 1 TTATTTAATG 0.99547 -130 TAGATAATTATATATTTTAAGGAGAATATTTT 1 32 0 TTTTTTAAGG 0.997341 -106 TTTTCCATGCTGTAATTTAAGGTTTCCCATTT 1 78 0 TTATTTAAGG 0.997323 -60 TGTTTTAACATGTTTTTTAATGAACAATTTTC 1 105 0 TTTTTTAATG 0.995887 -33 * * ******** Masking position 6 Map Score: 7.79341 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 15 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 ATCATTAAATGAGAATTGTAA 1 2 0 GAGAATTGTA 0.984176 -136 ATTTTAAGGAGAATATTTTATCATTAAATG 1 21 0 GAATATTTTA 0.946644 -117 AGACCAGGTAGATAATTATATATTTTAAGG 1 42 0 GATAATTATA 0.844464 -96 TTACAGCATGGAAAATTGTTCATTAAAAAA 1 95 1 GAAAATTGTT 0.947835 -43 ********** Masking position 5 Map Score: 3.91388 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 16 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 TATAATTATCTACCTGGTCTTTCCAGAAAT 1 52 1 TACCTGGTCT 0.983941 -86 ATTTAAGGTTTCCCATTTCTGGAAAGACCA 1 66 0 TCCCATTTCT 0.986338 -72 TCCCCTGTTTTAACATGTTTTTTAATGAAC 1 112 0 TAACATGTTT 0.853189 -26 CTAACATCCCCTGTTTTAACATGTTT 1 122 0 TCCCCTGTTT 0.992752 -16 ********** Masking position 8 Map Score: 2.10443 Number of sites scoring better than the average of aligned sites = 185 Number in coding regions = 175 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 GGAGAATATTTTATCATTAAATGAGAATTG 1 14 0 TTATCATTAA 0.98276 -124 TGATAAAATATTCTCCTTAAAATATATAAT 1 28 1 TTCTCCTTAA 0.990424 -110 CATGGAAAATTGTTCATTAAAAAACATGTT 1 101 1 TGTTCATTAA 0.986662 -37 ********** Masking position 9 Map Score: 1.90134 Number of sites scoring better than the average of aligned sites = 36 Number in coding regions = 23 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0