AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i061_Glutamate_Synthase_mthe_reg_300.orf -o061_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00475 137 M.thermo Motif number 1 AATATTTTATCATTAAATGAGAATTGTAA 1 8 0 CATTAAATAA 0.995401 -130 AAAATATTCTCCTTAAAATATATAATTATCTA 1 32 1 CCTTAAAAAA 0.997292 -106 AAATGGGAAACCTTAAATTACAGCATGGAAAA 1 78 1 CCTTAAATAA 0.997274 -60 GAAAATTGTTCATTAAAAAACATGTTAAAACA 1 105 1 CATTAAAAAA 0.995811 -33 ******** * * Masking position 6 Map Score: 7.79341 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 15 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 TTACAATTCTCATTTAATGAT 1 2 1 TACAATTCTC 0.984638 -136 CATTTAATGATAAAATATTCTCCTTAAAAT 1 21 1 TAAAATATTC 0.945188 -117 CCTTAAAATATATAATTATCTACCTGGTCT 1 42 1 TATAATTATC 0.853808 -96 TTTTTTAATGAACAATTTTCCATGCTGTAA 1 95 0 AACAATTTTC 0.950783 -43 ********** Masking position 5 Map Score: 3.91388 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 16 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 TATAATTATCTACCTGGTCTTTCCAGAAAT 1 52 1 TACCTGGTCT 0.984695 -86 ATTTAAGGTTTCCCATTTCTGGAAAGACCA 1 66 0 TCCCATTTCT 0.98699 -72 TCCCCTGTTTTAACATGTTTTTTAATGAAC 1 112 0 TAACATGTTT 0.85011 -26 CTAACATCCCCTGTTTTAACATGTTT 1 122 0 TCCCCTGTTT 0.993014 -16 ********** Masking position 8 Map Score: 2.10443 Number of sites scoring better than the average of aligned sites = 185 Number in coding regions = 175 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0