AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i077_Lipopolysaccharide_Biosynthesis_2__mthe_reg_300.orf -o077_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00306 48 M.thermo #2 RTH00146 60 M.thermo #3 RTH01779 194 M.thermo Motif number 1 GTGGTCTGTCTTCACATGCAAGGGA 1 6 1 CTGTCTTCAC 0.945049 -43 CAGTCCAGTCCAGTCCAGTCCATCCTATCC 3 103 0 CAGTCCAGTC 0.998795 -92 CAGTCCAGTCCAGTCCAGTCCAGTCCAGTC 3 113 0 CAGTCCAGTC 0.998795 -82 TTTATCAGTCCAGTCCAGTCCAGTCCAGTC 3 123 0 CAGTCCAGTC 0.998795 -72 TCTGCATTCACTGTCTACTCCAGGATCTTT 3 151 0 CTGTCTACTC 0.994129 -44 ********** Masking position 4 Map Score: 12.4232 Number of sites scoring better than the average of aligned sites = 34 Number in coding regions = 25 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 TCCTCACGCTTAACTCCCTTGCATGTGAAG 1 20 0 TAACTCCCTT 0.900394 -29 GGCATCATCTCCTCACGCTTAAC 1 36 0 ATCATCTCCT 0.97065 -13 CTCTGATGAGTTAATCCCTATGAGGAATGC 2 28 0 TTAATCCCTA 0.898942 -33 TCAATCATCCTTTCTCTGATGAG 2 48 0 ATCATCCTTT 0.929409 -13 TCCTATCCTATTCCTCCCTTAAACCTACAG 3 81 0 TTCCTCCCTT 0.993774 -114 AGTCCAGTCCATCCTATCCTATTCCTCCCT 3 92 0 ATCCTATCCT 0.838195 -103 TTTTCATCTCTCCATGTTCGAG 3 183 0 TTCATCTCTC 0.959016 -12 ********** Masking position 5 Map Score: 3.59339 Number of sites scoring better than the average of aligned sites = 1442 Number in coding regions = 1347 Number in noncoding regions = 95 Number of orfs with sites within 600 bp upstream = 88 Fraction of orfs with sites within 600 bp upstream = 0.0141343 Motif number 3 CAAGGGAGTTAAGCGTGAGGAGATGATGCC 1 29 1 AAGCGGAGAG 0.980739 -20 GGAATGCCGGGACCTCCAGAAGTG 2 3 0 GACCTCAGAG 0.989805 -58 TCCTCCCTTAAACCTACAGCAGTAAAAATCTG 3 68 0 AACCTCAGAG 0.992604 -127 CTGATAAAAGATCCTGGAGTAGACAGTGAATG 3 145 1 ATCCTGAGAG 0.897321 -50 GTGAATGCAGATCCTCGAACATGGAGAGATGA 3 170 1 ATCCTGAAAT 0.675149 -25 ***** *** ** Masking position 8 Map Score: 2.17954 Number of sites scoring better than the average of aligned sites = 476 Number in coding regions = 460 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 GTCCCGGCATTCCTCATAGGGATTAACTCA 2 22 1 TCCTCATAGG 0.992412 -39 AGGGATTAACTCATCAGAGAAAGGATGATT 2 39 1 TCATCAGAGA 0.978249 -22 GCACCCCACATCATCATACGAAAAGTTTAA 3 36 0 TCATCATACG 0.988372 -159 TGAATGCAGATCCTCGAACATGGAGAGATG 3 171 1 TCCTCGAACA 0.958242 -24 ********** Masking position 4 Map Score: 1.107 Number of sites scoring better than the average of aligned sites = 172 Number in coding regions = 161 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 5 ********** No masking Map Score: -2.53363e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.53363e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.53363e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0