AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i099_Phosphate_Transport_1_mthe_reg_100.orf -o099_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01686 117 M.thermo #2 RTH01759 83 M.thermo #3 RTH00143 17 M.thermo #4 RTH01466 21 M.thermo Motif number 1 CGCAGAGGAATTTAATTCACAATAA 1 6 0 TTTAATTCAC 0.98488 -112 GCGCACAGGGTTTAGTTCACAAAATAGGTA 1 33 1 TTTAGTTCAC 0.994865 -85 AAATAGGTAATTAAGTACACAAAAATAGTA 1 54 1 TTAAGTACAC 0.98613 -64 TAGAACTATTTAAAATTTACTATTTTTGTG 1 71 0 TAAAATTTAC 0.912734 -47 TATTGGTTAATAAAGTTCACTTGAAGGTGA 2 44 0 TAAAGTTCAC 0.993545 -40 CTTCAGTTATTGATTTCACCTATTGGTTA 2 65 0 TTGATTTCAC 0.971719 -19 ********** Masking position 6 Map Score: 10.635 Number of sites scoring better than the average of aligned sites = 113 Number in coding regions = 101 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 TTATTGTGAATTAAATTCCTCTGCGCACAG 1 11 1 TTAAATTCCT 0.894491 -107 TTTTGTGTACTTAATTACCTATTTTGTGAA 1 48 0 TTAATTACCT 0.973234 -70 TTTATCACCTCAACCTTTAC 1 108 0 TTTATCACCT 0.982811 -10 TGGTTTTCACAACCACAACATTTT 2 5 1 TTTCACAACC 0.877742 -79 CACAACATTTTTTCTTTCCGTCACCTTCAA 2 24 1 TTTCTTTCCG 0.909225 -60 TCAAGTGAACTTTATTAACCAATAGGTGAA 2 50 1 TTTATTAACC 0.953072 -34 TTAATCCCCCCAACTAT 3 8 0 TTAATCCCCC 0.968851 -10 ********** Masking position 2 Map Score: 4.71251 Number of sites scoring better than the average of aligned sites = 445 Number in coding regions = 349 Number in noncoding regions = 96 Number of orfs with sites within 600 bp upstream = 90 Fraction of orfs with sites within 600 bp upstream = 0.0144555 Motif number 3 TTTACCTTATCCTAGAACTATTTAAAATTTA 1 82 0 CCAGAACTAT 0.947267 -36 TTTATCACCTCAACCTTTACCTTATCCT 1 100 0 CCCAACCTTT 0.996366 -18 GTTTTCACAACCACAACATTTTTTCTTTCCG 2 13 1 CCCAACATTT 0.981319 -71 TTTTTTCTTTCCGTCACCTTCAAGTGAACTT 2 31 1 CCTCACCTTC 0.979625 -53 TTAATCCCCCCAACTAT 3 1 0 CCCCAACTAT 0.992444 -17 ** ******** Masking position 6 Map Score: 2.7181 Number of sites scoring better than the average of aligned sites = 370 Number in coding regions = 329 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 4 GTGTACTTAATTACCTATTTTGTGAACTAA 1 44 0 TTACCTATTT 0.985338 -74 CTATTTAAAATTTACTATTTTTGTGTACTT 1 66 0 TTTACTATTT 0.906988 -52 GTTATTGATTTCACCTATTGGTTAATAAAG 2 59 0 TCACCTATTG 0.993819 -25 CTTCAGTTATTGATTTCACCTA 2 72 0 TCAGTTATTG 0.956506 -12 ********** Masking position 6 Map Score: 0.826215 Number of sites scoring better than the average of aligned sites = 81 Number in coding regions = 72 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0