AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i099_Phosphate_Transport_1_mthe_reg_300.orf -o099_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01686 117 M.thermo #2 RTH01759 83 M.thermo #3 RTH00143 17 M.thermo #4 RTH01466 21 M.thermo Motif number 1 TTATTGTGAATTAAATTCCTCTGCG 1 6 1 GTGAATTAAA 0.98473 -112 TACCTATTTTGTGAACTAAACCCTGTGCGC 1 33 0 GTGAACTAAA 0.994762 -85 TACTATTTTTGTGTACTTAATTACCTATTT 1 54 0 GTGTACTTAA 0.985834 -64 CACAAAAATAGTAAATTTTAAATAGTTCTA 1 71 1 GTAAATTTTA 0.911058 -47 TCACCTTCAAGTGAACTTTATTAACCAATA 2 44 1 GTGAACTTTA 0.993407 -40 TAACCAATAGGTGAAATCAATAACTGAAG 2 65 1 GTGAAATCAA 0.971348 -19 ********** Masking position 5 Map Score: 10.635 Number of sites scoring better than the average of aligned sites = 113 Number in coding regions = 101 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 2 CTGTGCGCAGAGGAATTTAATTCACAATAA 1 11 0 AGGAATTTAA 0.904622 -107 TTCACAAAATAGGTAATTAAGTACACAAAA 1 48 1 AGGTAATTAA 0.976007 -70 GTAAAGGTTGAGGTGATAAA 1 108 1 AGGTGATAAA 0.984607 -10 AAAATGTTGTGGTTGTGAAAACCA 2 5 0 GGTTGTGAAA 0.889282 -79 TTGAAGGTGACGGAAAGAAAAAATGTTGTG 2 24 0 CGGAAAGAAA 0.91807 -60 TTCACCTATTGGTTAATAAAGTTCACTTGA 2 50 0 GGTTAATAAA 0.957843 -34 ATAGTTGGGGGGATTAA 3 8 1 GGGGGATTAA 0.972064 -10 ********** Masking position 9 Map Score: 4.71251 Number of sites scoring better than the average of aligned sites = 445 Number in coding regions = 349 Number in noncoding regions = 96 Number of orfs with sites within 600 bp upstream = 90 Fraction of orfs with sites within 600 bp upstream = 0.0144555 Motif number 3 TTTACCTTATCCTAGAACTATTTAAAATTTA 1 82 0 CCAGAACTAT 0.944868 -36 TTTATCACCTCAACCTTTACCTTATCCT 1 100 0 CCCAACCTTT 0.996191 -18 GTTTTCACAACCACAACATTTTTTCTTTCCG 2 13 1 CCCAACATTT 0.980438 -71 TTTTTTCTTTCCGTCACCTTCAAGTGAACTT 2 31 1 CCTCACCTTC 0.978665 -53 TTAATCCCCCCAACTAT 3 1 0 CCCCAACTAT 0.992083 -17 ** ******** Masking position 6 Map Score: 2.7181 Number of sites scoring better than the average of aligned sites = 370 Number in coding regions = 329 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 4 GTGTACTTAATTACCTATTTTGTGAACTAA 1 44 0 TTACCTATTT 0.984197 -74 CTATTTAAAATTTACTATTTTTGTGTACTT 1 66 0 TTTACTATTT 0.900365 -52 GTTATTGATTTCACCTATTGGTTAATAAAG 2 59 0 TCACCTATTG 0.993334 -25 CTTCAGTTATTGATTTCACCTA 2 72 0 TCAGTTATTG 0.953227 -12 ********** Masking position 6 Map Score: 0.826215 Number of sites scoring better than the average of aligned sites = 81 Number in coding regions = 72 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0