AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i107_TRK_operon_mthe_reg_100.orf -o107_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00419 300 M.thermo #2 RTH00556 142 M.thermo Motif number 1 AGAAAATAGCTTAACAGCGGACCTTCATCC 1 61 0 TTAACAGCGG 0.99546 -240 TTCTTCCATAATAACACCAGCTGCTTTTAA 1 87 1 ATAACACCAG 0.965198 -214 AAATGAGGGTTTAAAAGCAGCTGGTGTTAT 1 97 0 TTAAAAGCAG 0.956691 -204 TATTCCCCCATAAACAGCAGCATACAGACA 1 130 1 TAAACAGCAG 0.981757 -171 AATACAGCATATTCCAGCGGCCGCTCTAAA 1 188 1 ATTCCAGCGG 0.894645 -113 AATATAGGTTTTTAGAGCGGCCGCTGGAAT 1 198 0 TTTAGAGCGG 0.976014 -103 AATATAAATTTTTAGAGCGGCAGGTTATGG 1 261 0 TTTAGAGCGG 0.976014 -40 ATGATGAGGTTTAACACAAGTAAACACCAC 2 77 1 TTAACACAAG 0.895877 -66 TTAACACAAGTAAACACCACTTACATTGAT 2 87 1 TAAACACCAC 0.801183 -56 ********** Masking position 6 Map Score: 11.6346 Number of sites scoring better than the average of aligned sites = 317 Number in coding regions = 280 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 2 TCAGCGGTAGGATGAAGGTCCGCTGTTAAG 1 52 1 GATGAAGGTC 0.946091 -249 GGAATATCTAAATGAGGGTTTAAAAGCAGC 1 106 0 AATGAGGGTT 0.992891 -195 AGGATATTGCAATATAGGTTTTTAGAGCGG 1 208 0 AATATAGGTT 0.906071 -93 TTCCACTTATAATAAGGGTTTCAGTAACTC 2 36 0 AATAAGGGTT 0.991429 -107 CCTCATCATTAATAAGGTTTTTCCACTTAT 2 56 0 AATAAGGTTT 0.969298 -87 CCTTATTAATGATGAGGTTTAACACAAGTA 2 69 1 GATGAGGTTT 0.978743 -74 CACTTACATTGATACCGGTTACATTGATTT 2 104 1 GATACCGGTT 0.935544 -39 ********** Masking position 2 Map Score: 7.60914 Number of sites scoring better than the average of aligned sites = 286 Number in coding regions = 253 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 3 TTAAGCTATTTTCTTCCATAATAACACCAGC 1 77 1 TTCTCCATAA 0.977021 -224 CATTTAGATATTCCCCCATAAACAGCAGCAT 1 122 1 TTCCCCATAA 0.995545 -179 TCAACTACTATCCACCCATAACCTGCCGCTC 1 246 1 TCCCCCATAA 0.998023 -55 TGCTCAACCCATAAAAAATGATCT 2 4 1 TCACCCATAA 0.98976 -139 ATAAGGTTTTTCCACTTATAATAAGGGTTTC 2 44 0 TCCCTTATAA 0.948837 -99 *** ******* Masking position 8 Map Score: 6.81437 Number of sites scoring better than the average of aligned sites = 124 Number in coding regions = 104 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 4 AATATCTAAATGAGGGTTTAAAAGCAGCTG 1 104 0 TGAGGGTTTA 0.978409 -197 TAATGGTATCTGACGGATACTGTCTGAGCT 1 159 0 TGACGGATAC 0.929436 -142 CCACTTATAATAAGGGTTTCAGTAACTCCA 2 34 0 TAAGGGTTTC 0.984835 -109 TCATCATTAATAAGGTTTTTCCACTTATAA 2 54 0 TAAGGTTTTT 0.846735 -89 TTATTAATGATGAGGTTTAACACAAGTAAA 2 71 1 TGAGGTTTAA 0.938721 -72 CTTACATTGATACCGGTTACATTGATTTTT 2 106 1 TACCGGTTAC 0.925457 -37 ********** Masking position 8 Map Score: 1.67592 Number of sites scoring better than the average of aligned sites = 759 Number in coding regions = 716 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 5 ACTCATCGAAATTTATTTTTTGGTTCAGGT 1 22 1 ATTTATTTTT 0.906452 -279 ATATTGCAATATAGGTTTTTAGAGCGGCCG 1 205 0 ATAGGTTTTT 0.975852 -96 ACATTGCAATATAAATTTTTAGAGCGGCAG 1 268 0 ATAAATTTTT 0.892181 -33 CTCATCATTAATAAGGTTTTTCCACTTATA 2 55 0 ATAAGGTTTT 0.922215 -88 TACCGGTTACATTGATTTTTCCCTGAATCT 2 116 1 ATTGATTTTT 0.963375 -27 ********** Masking position 7 Map Score: 2.58539 Number of sites scoring better than the average of aligned sites = 54 Number in coding regions = 25 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 6 CCTACCGCTGAACCTGAACCAAAAAATAAA 1 33 0 AACCTGAACC 0.946259 -268 GCGGACCTTCATCCTACCGCTGAACCTGAA 1 45 0 ATCCTACCGC 0.976989 -256 TCCATAATAACACCAGCTGCTTTTAAACCC 1 91 1 CACCAGCTGC 0.961915 -210 ATTCCCCCATAAACAGCAGCATACAGACAG 1 131 1 AAACAGCAGC 0.949606 -170 ATATTGCAATATCCTGACGCTACTCAACTA 1 223 1 ATCCTGACGC 0.989332 -78 ATCCACCCATAACCTGCCGCTCTAAAAATT 1 255 1 AACCTGCCGC 0.998051 -46 ********** Masking position 4 Map Score: 5.68113 Number of sites scoring better than the average of aligned sites = 350 Number in coding regions = 329 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 7 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.88842e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0