AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i118_SecDF_mthe_reg_300.orf -o118_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01872 170 M.thermo #2 RTH01186 59 M.thermo #3 RTH01810 103 M.thermo Motif number 1 GGGGAAGATATCCCCATGGACAGTTAA 1 2 1 GGGAAATCAT 0.966442 -169 ACCCGGTCGTGGCCACCAAAATTTATAAGTATTTCA 1 48 0 GGCCAAATAT 0.992751 -123 GCCACGACCGGGTCAGTGATGGACATTATATGGGTG 1 71 1 GGTCAATCAT 0.996339 -100 GGTATGGTGGGGCCTCCCACCCATATAATGTCCATC 1 88 0 GGCCTACTAT 0.926813 -83 AGAGTACCCAGGTCAGTGATGGACATTATATAGGTG 1 138 1 GGTCAATCAT 0.996339 -33 GTTATTAAATGGGCAGAAATATATATGATGCCATCA 2 20 1 GGGCAATTAT 0.991367 -40 ATATATATGATGCCATCAAATCTCATCCCTAG 2 38 1 TGCCAAACAT 0.971709 -22 TTTAAAATGCGGTCAATCAAGACGATCACCTTTAAA 3 34 0 GGTCAAAGAT 0.974934 -70 AAGTCATACAGGCCACTCATAGCCATACCAGCAGCC 3 68 1 GGCCAATCAT 0.998224 -36 ***** ** *** Masking position 9 Map Score: 16.1515 Number of sites scoring better than the average of aligned sites = 154 Number in coding regions = 134 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 2 GAAGATATCCCCATGGACAGTTAAAGGTTGT 1 14 1 CCAGGACAGT 0.995796 -157 GGTGGCCACGACCGGGTCAGTGATGGACATT 1 67 1 ACCGGTCAGT 0.993892 -104 GACCTGGGTACTCTGGATAGTCTGCGAGGGT 1 121 0 CTCGGATAGT 0.983506 -50 ATCCAGAGTACCCAGGTCAGTGATGGACATT 1 134 1 CCCGGTCAGT 0.998841 -37 CACAGGACCGTTATTAAATGG 2 1 1 CACGGACCGT 0.992917 -59 *** ******* Masking position 11 Map Score: 7.47704 Number of sites scoring better than the average of aligned sites = 102 Number in coding regions = 90 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 3 GAAGATATCCCCATGGACAGTTAAAGGTTG 1 14 1 CCATGGACAG 0.992022 -157 GGTGGCCACGACCGGGTCAGTGATGGACAT 1 67 1 ACCGGGTCAG 0.980818 -104 GACCTGGGTACTCTGGATAGTCTGCGAGGG 1 122 0 CTCTGGATAG 0.934024 -49 ATCCAGAGTACCCAGGTCAGTGATGGACAT 1 134 1 CCCAGGTCAG 0.994472 -37 CACAGGACCGTTATTAAATG 2 1 1 CACAGGACCG 0.976669 -59 GACCGTTATTAAATGGGCAGAAATATATAT 2 16 1 AAATGGGCAG 0.916581 -44 ********** Masking position 5 Map Score: 4.62588 Number of sites scoring better than the average of aligned sites = 585 Number in coding regions = 542 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 4 GTCAGTGATGGACATTATATGGGTGGGAGG 1 82 1 GACATTATAT 0.994085 -89 GTCAGTGATGGACATTATATAGGTGGGTAT 1 149 1 GACATTATAT 0.994085 -22 GAGATTTGATGGCATCATATATATTTCTGC 2 32 0 GGCATCATAT 0.991648 -28 ********** Masking position 4 Map Score: 3.45596 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 6 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 5 GGAGGCCCCACCATACCCTCGCAGACTATC 1 107 1 CCATACCCTC 0.997669 -64 CTATACCCACCTATATAATG 1 161 0 CTATACCCAC 0.993667 -10 CCACTCATAGCCATACCAGCAGCCATAACT 3 80 1 CCATACCAGC 0.995718 -24 ********** Masking position 5 Map Score: 2.45262 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 38 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 6 GTATTTCATGGACAACCTTTAACTGTCCAT 1 26 0 GACAACCTTT 0.993559 -145 TGACAGATGGGAGAAACTTTAAAGGTGATC 3 17 1 GAGAAACTTT 0.954752 -87 CAATCAAGACGATCACCTTTAAAGTTTCTC 3 27 0 GATCACCTTT 0.988699 -77 CGTCTTGATTGACCGCATTTTAAAGTCATA 3 46 1 GACCGCATTT 0.972387 -58 ********** Masking position 8 Map Score: 1.40485 Number of sites scoring better than the average of aligned sites = 57 Number in coding regions = 48 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 7 TTATAAATTTTGGTGGCCACGACCGGGTCA 1 56 1 TGGTGGCCAC 0.996523 -115 TTATATGGGTGGGAGGCCCCACCATACCCT 1 96 1 GGGAGGCCCC 0.987204 -75 TTTAAAGTCATACAGGCCACTCATAGCCAT 3 64 1 TACAGGCCAC 0.990314 -40 ********** Masking position 5 Map Score: 0.706646 Number of sites scoring better than the average of aligned sites = 49 Number in coding regions = 46 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 8 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0