AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i150_ATP_synthase_1_mthe_reg_100.orf -o150_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00559 35 M.thermo #2 RTH00866 17 M.thermo #3 RTH00917 212 M.thermo Motif number 1 TGAAATTTAATTTGAATTAAGACAATATTT 3 59 0 TTTGAATTAA 0.982221 -154 TTCAAATTAAATTTCATAAAATGACTCAAT 3 73 1 ATTTCATAAA 0.841637 -140 TCATAAAATGACTCAATTAACATCAGGAGG 3 86 1 ACTCAATTAA 0.956901 -127 AACTAATCCCATTCAGTTAACCAAGCCTTT 3 122 0 ATTCAGTTAA 0.956897 -91 AGTTTATGATATTCAACTAATCCCATTCAG 3 136 0 ATTCAACTAA 0.956895 -77 ATCATAAACTTTTGAATAAAATAGTAAAAG 3 156 1 TTTGAATAAA 0.958957 -57 GAAATAGACCTTTGCATTAATAGG 3 199 1 TTTGCATTAA 0.973555 -14 ********** Masking position 9 Map Score: 6.57728 Number of sites scoring better than the average of aligned sites = 74 Number in coding regions = 40 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 2 CCACCCCCAACATCCTTTTTCAGGAGAGT 1 9 1 AACATCCTTT 0.96439 -27 TGGCTAACTCTCCTGAAAAAGGATGT 1 20 0 AACTCTCCTA 0.977061 -16 CTGTTATCTCCCCTTTT 2 2 0 ATCTCCCCTT 0.992129 -16 TTCACCCATCAACATCCATATGATTGCCGAT 3 13 1 AACATCCATT 0.938876 -200 ATGATTGCCGATCACCCTTAAAGACTTAAAT 3 32 1 ATCACCCTTA 0.987679 -181 AGCCTTTTGAATCCCTCCTGATGTTAATTGA 3 98 0 ATCCCTCCTA 0.972827 -115 ********* * Masking position 9 Map Score: 3.41699 Number of sites scoring better than the average of aligned sites = 711 Number in coding regions = 660 Number in noncoding regions = 51 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 3 CCACCCCCAACATCCTTTTTCAGGAG 1 6 1 CCCAACACCT 0.997732 -30 AATTCACCCATCAACATCCATATGATT 3 7 1 CCCATCACAT 0.996499 -206 CATATGATTGCCGATCACCCTTAAAGACTTA 3 29 1 CCGATCACCT 0.99757 -184 ******* *** Masking position 7 Map Score: 2.51747 Number of sites scoring better than the average of aligned sites = 29 Number in coding regions = 24 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 4 GCTAACTCTCCTGAAAAAGGATGTTGGGGG 1 14 0 CTGAAAAAGG 0.967158 -22 ATCAGGAGGGATTCAAAAGGCTTGGTTAAC 3 107 1 ATTCAAAAGG 0.992301 -106 TTACTATTTTATTCAAAAGTTTATGATATT 3 153 0 ATTCAAAAGT 0.988141 -60 CCTATTAATGCAAAGGTCTATTTCGCG 3 196 0 ATGCAAAGGT 0.986952 -17 ********** Masking position 5 Map Score: 3.05843 Number of sites scoring better than the average of aligned sites = 36 Number in coding regions = 29 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 5 AATTAAGACAATATTTAAGTCTTTAAGGGT 3 45 0 ATATTTAAGT 0.980407 -168 TCATTTTATGAAATTTAATTTGAATTAAGA 3 67 0 AAATTTAATT 0.928459 -146 AAAGTTTATGATATTCAACTAATCCCATTC 3 138 0 ATATTCAACT 0.981814 -75 ATTTCGCGGTATATTTATCTTTTACTATTT 3 174 0 ATATTTATCT 0.971538 -39 ********** Masking position 5 Map Score: 2.04713 Number of sites scoring better than the average of aligned sites = 38 Number in coding regions = 23 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 6 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0