AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i154_Hydrogenase_1_mthe_reg_100.orf -o154_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01924 221 M.thermo Motif number 1 CTTGACCCACATACTAAATGTGTTGTTAACACCAGG 1 19 0 ATATATGTGT 0.983589 -203 TTGTTCAGTAATACTGAGTGTTATATATCTTGACCC 1 47 0 ATATATGTTT 0.996124 -175 AGAGTTTATAATATTAATTTTTTGTTCAGTAATACT 1 68 0 ATATATTTTT 0.990401 -154 AATTAATATTATAAACTCTGTTTTCTACTAATAATA 1 85 1 ATAATTGTTT 0.95411 -137 TTTTCTACTAATAATAAGTGATCTATAAAATGATAT 1 105 1 ATATATGATT 0.976168 -117 ATAAAATGATATAAATAGTTTTCACTTTTTTTATAA 1 129 1 ATAAATTTTT 0.97799 -93 CTTCAATATTATAACTATTTTTAAATGTTATAAGTT 1 171 0 ATACATTTTT 0.971167 -51 AATAGTTATAATATTGAAGGTTTTTTGAACTTTAAA 1 188 1 ATATAGGTTT 0.985974 -34 *** * * **** * Masking position 3 Map Score: 11.5802 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 20 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 2 CCTTCCTGGTGTTAACAACACATTTAGTAT 1 15 1 GTTAACAACA 0.960009 -207 CAGTATTACTGAACAAAAAATTAATATTAT 1 67 1 GAACAAAAAA 0.898233 -155 CTTATTATTAGTAGAAAACAGAGTTTATAA 1 93 0 GTAGAAAACA 0.923654 -129 TCTATAAAATGATATAAATAGTTTTCACTT 1 126 1 GATATAAATA 0.817438 -96 GTTTTTCAATTATAAAAAAAGTGAAAACTA 1 144 0 TATAAAAAAA 0.933115 -78 ACTTATAACATTTAAAAATAGTTATAATAT 1 172 1 TTTAAAAATA 0.93983 -50 TGTTTTTAAAGTTCAAAAAACCTTCAATAT 1 198 0 GTTCAAAAAA 0.974784 -24 TTTTTTGAACTTTAAAAACAAGAG 1 208 1 TTTAAAAACA 0.972453 -14 ********** Masking position 7 Map Score: 7.47037 Number of sites scoring better than the average of aligned sites = 251 Number in coding regions = 186 Number in noncoding regions = 65 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 3 GTCAAGATATATAACACTCAGTATTACTGA 1 49 1 ATAACACTCA 0.920163 -173 AGAGTTTATAATATTAATTTTTTGTTCAGT 1 74 0 ATATTAATTT 0.824561 -148 ATCATTTTATAGATCACTTATTATTAGTAG 1 109 0 AGATCACTTA 0.948664 -113 AAAACTATTTATATCATTTTATAGATCACT 1 121 0 ATATCATTTT 0.968434 -101 ATATAAATAGTTTTCACTTTTTTTATAATT 1 137 1 TTTTCACTTT 0.903227 -85 TGTTATAAGTTTTTCAATTATAAAAAAAGT 1 152 0 TTTTCAATTA 0.855816 -70 TGAAAAACTTATAACATTTAAAAATAGTTA 1 166 1 ATAACATTTA 0.950603 -56 CTTCAATATTATAACTATTTTTAAATGTTA 1 177 0 ATAACTATTT 0.831815 -45 ********** Masking position 8 Map Score: 4.26987 Number of sites scoring better than the average of aligned sites = 311 Number in coding regions = 246 Number in noncoding regions = 65 Number of orfs with sites within 600 bp upstream = 77 Fraction of orfs with sites within 600 bp upstream = 0.0123675 Motif number 4 GTGGGTCAAGATATATAACACTCAGTATTAC 1 45 1 ATAATAACAC 0.945306 -177 ACACTCAGTATTACTGAACAAAAAATTAATA 1 62 1 TTATGAACAA 0.945045 -160 TTATATCATTTTATAGATCACTTATTATTAG 1 112 0 TTAAGATCAC 0.98751 -110 AATGATATAAATAGTTTTCACTTTTTTTATA 1 133 1 ATATTTTCAC 0.923462 -89 CTCTTGTTTTTAAAGTTCAAAAAACCTTCA 1 202 0 TTAAGTTCAA 0.95819 -20 *** ******* Masking position 3 Map Score: 0.562592 Number of sites scoring better than the average of aligned sites = 90 Number in coding regions = 64 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 5 ********** No masking Map Score: -3.31523e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.31523e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.31523e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0