AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i156_HYP_operon_mthe_reg_100.orf -o156_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00077 20 M.thermo #2 RTH01952 83 M.thermo #3 RTH01119 67 M.thermo #4 RTH01092 177 M.thermo #5 RTH00291 110 M.thermo Motif number 1 GTAATTAACAATTTTTATATAGATAACTCTA 2 27 1 ATTTTTATTA 0.97325 -57 TCTGACAAAATTTTATAATTAGAATTAATAG 2 55 0 TTTTATAATA 0.757357 -29 TATCACGATCATATATATATGGAGGAGGCCA 3 18 0 ATATATATTG 0.892754 -50 TGATAAATAGATCTTTAAGTGTAATGGTGGT 3 44 1 ATCTTTAATG 0.964083 -24 TACCTAATTTATAAGTACATCAATATA 4 7 1 ATTTATAATA 0.945703 -171 GGCACGGTACATTTCTATCTACCTTGAGTTT 4 62 0 ATTTCTATTA 0.942496 -116 TTTCCCACAAATCTTTATATGTGACGGATCT 5 32 1 ATCTTTATTG 0.977306 -79 TATGTGACGGATCTTTATCTAAACATTAGTG 5 49 1 ATCTTTATTA 0.977746 -62 ******** ** Masking position 7 Map Score: 6.77788 Number of sites scoring better than the average of aligned sites = 99 Number in coding regions = 41 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 80 Fraction of orfs with sites within 600 bp upstream = 0.0128493 Motif number 2 TATATATATGGAGGAGGCCAAAGGATT 3 2 0 GGGGCAAGGT 0.98261 -66 TATCTACCTTGAGTTTGCATGAGTTCTCCTATGCTA 4 42 0 GGTGCTAGTC 0.988293 -136 CCTCCACTGTGAGATGGGCACGGTACATTTCTATCT 4 73 0 GGGGGAGGTC 0.993745 -105 CCATCTCACAGTGGAGGGAATAGTCCAGGGCGTTGG 4 92 1 GGGGGAAGTC 0.997735 -86 ATAGTCCAGGGCGTTGGCTTCAGGCCAGCGGTCTAC 4 111 1 GGGGCTAGGC 0.997265 -67 CTCACGTATCCCGTGAGGCTGAGTTCCTTTGCAAGT 4 149 0 CGAGGTAGTC 0.950877 -29 * * *** * *** * Masking position 7 Map Score: 3.05161 Number of sites scoring better than the average of aligned sites = 118 Number in coding regions = 106 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 3 TTTATAATTAGAATTAATAGAGTTATCTAT 2 45 0 GAATTAATAG 0.947986 -39 CAATGCCATTGAATTAATACC 5 2 0 GAATTAATAC 0.726683 -109 AACCCTCTCCAAATTAATAGGATTAAAGTC 5 86 0 AAATTAATAG 0.969701 -25 ********** Masking position 6 Map Score: 1.65943 Number of sites scoring better than the average of aligned sites = 5 Number in coding regions = 2 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 CTTTAGTCTGACAAAATTTTATAATTAGAA 2 62 0 ACAAAATTTT 0.85355 -22 ATCGTGATAAATAGATCTTTAAGTGTAATG 3 40 1 ATAGATCTTT 0.797986 -28 ATTGTTTCCCACAAATCTTTATATGTGACG 5 28 1 ACAAATCTTT 0.93766 -83 TTTATATGTGACGGATCTTTATCTAAACAT 5 45 1 ACGGATCTTT 0.967707 -66 GTCAGAATACACTAATGTTTAGATAAAGAT 5 59 0 ACTAATGTTT 0.919635 -52 ********** Masking position 5 Map Score: 0.94435 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 21 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 5 TATAATCTTAGCATAGGAGAACTCATGCAA 4 34 1 GCATAGGAGA 0.952586 -144 TCATGCAAACTCAAGGTAGATAGAAATGTA 4 56 1 TCAAGGTAGA 0.97456 -122 TGTGAGATGGGCACGGTACATTTCTATCTA 4 72 0 GCACGGTACA 0.984167 -106 CGTGCCCATCTCACAGTGGAGGGAATAGTC 4 87 1 TCACAGTGGA 0.968243 -91 GAACTCAGCCTCACGGGATACGTGAGAAC 4 159 1 TCACGGGATA 0.976657 -19 ********** Masking position 3 Map Score: 0.716134 Number of sites scoring better than the average of aligned sites = 261 Number in coding regions = 241 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 6 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0