AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i159_glycolate_Oxidase_mthe_reg_100.orf -o159_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00981 105 M.thermo #2 RTH01957 163 M.thermo Motif number 1 TTTAATTGTTTATCAACACATATTAAGGTTTGTGATTT 1 42 0 TTCAATTAGG 0.984389 -64 AACAATTAAAATTCAGTTCATTCTGAAGTTTTTCATAT 1 70 1 ATCAATTAAG 0.942013 -36 GCACCGTCATACCTACTTGAGGCACCCTTCTA 2 5 1 CTCATATAGG 0.971323 -159 AGGTTACAGCATTCTGGAAATGGTTAAGTAGAAGGGTG 2 33 0 ATCTATTAAG 0.95301 -131 TAAAGGTTACACTCTCGCGAATTTTAGGAATCTTTATA 2 71 1 ATCTAATAGG 0.988413 -93 AGACTGTGACTCTCATCTCTATATAAAGATTCCTAAAA 2 92 0 TTCATATAAG 0.958259 -72 GTCACAGTCTAATAAGAAAAATCTGAGGTTTGCTAACC 2 120 1 ATAAAATAGG 0.937408 -44 GAGGTTTGCTAACCAGGGATATTTCAGGGT 2 144 1 ACCATATAGG 0.974791 -20 * *** ** * *** Masking position 16 Map Score: 5.35512 Number of sites scoring better than the average of aligned sites = 232 Number in coding regions = 206 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 2 ATTATCAGTTAAAATCACAAACCTTAATAT 1 31 1 AAAATCACAA 0.925756 -75 TGTAACCTTTAAGGTTACAGCATTCTGGAA 2 52 0 AAGGTTACAG 0.992654 -112 TGTAACCTTAAAGGTTACACTCTCGCGAAT 2 63 1 AAGGTTACAC 0.986564 -101 TATAGAGATGAGAGTCACAGTCTAATAAGA 2 107 1 AGAGTCACAG 0.987541 -57 ********** Masking position 5 Map Score: 1.22214 Number of sites scoring better than the average of aligned sites = 145 Number in coding regions = 135 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 ACTGATAATCTTTTAAACAATACAGACAT 1 5 0 TTTTAATCAG 0.971076 -101 AACAATTAAAATTCAGTTCATTCTGAAGTTTTTCA 1 70 1 ATTCTATCTG 0.972319 -36 TTCTGAAGTTTTTCATATGAGTCAGC 1 90 1 TTTCAAGCAG 0.988005 -16 CTACTTAACCATTTCCAGAATGCTGTAACCTTAAA 2 40 1 ATTTAATCTG 0.979638 -124 CTATATAAAGATTCCTAAAATTCGCGAGAGTGTAA 2 77 0 ATTCAATCGC 0.950371 -87 ACCTCAGATTTTTCTTATTAGACTGTGACTCTCAT 2 114 0 TTTCAAGCTG 0.991599 -50 **** * ** *** Masking position 10 Map Score: 1.22091 Number of sites scoring better than the average of aligned sites = 102 Number in coding regions = 85 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 4 GTCTGTATTGTTTAAAAGATTATCAGTTAA 1 13 1 TTTAAAAGAT 0.899458 -93 GGTTTGTGATTTTAACTGATAATCTTTTAA 1 24 0 TTTAACTGAT 0.966543 -82 ATGAACTGAATTTTAATTGTTTATCAACAC 1 61 0 TTTTAATTGT 0.884625 -45 CATTCTGAAGTTTTTCATATGAGTCAGC 1 88 1 TTTTTCATAT 0.949162 -18 AAACCTCAGATTTTTCTTATTAGACTGTGA 2 121 0 TTTTTCTTAT 0.963967 -43 ********** Masking position 3 Map Score: 0.625878 Number of sites scoring better than the average of aligned sites = 126 Number in coding regions = 83 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 5 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0