AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i173_1_17_4_2_mthe_reg_100.orf -o173_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01486 123 M.thermo #2 RTH00930 246 M.thermo Motif number 1 CGATATGAATGCCTTATTAAATGAATAATA 2 102 1 GCCTTATTAA 0.983813 -145 ATTATTTAAACCCTTATAAAGGTGTTATTA 2 140 1 CCCTTATAAA 0.995722 -107 TGCCGCGCCCCCCTTAAAAATCATCGGCTG 2 172 0 CCCTTAAAAA 0.98606 -75 ATGTTCACCACCCATATTAAAGGTGCCGCG 2 195 0 CCCATATTAA 0.980169 -52 CTCCTTATAGAATCTAATGTC 2 236 0 TCCTTATAGA 0.955683 -11 ********** Masking position 5 Map Score: 5.94367 Number of sites scoring better than the average of aligned sites = 105 Number in coding regions = 89 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 CTGGGATCATTCCATCGGCCTGTTCCCTGT 1 44 1 TCCATCGGCC 0.987481 -80 AGTCAGAGCCCTCATCATCCACAAGGAAAC 1 94 0 CTCATCATCC 0.988628 -30 TAAGGGGCTCTGCATCATCCTCTCTGTTTT 2 47 0 TGCATCATCC 0.991242 -200 AAAGGTGTTATTAATCAGCCGATGATTTTT 2 157 1 TTAATCAGCC 0.982818 -90 TAATTTTATGTTCACCACCCATATTAAAGG 2 202 0 TTCACCACCC 0.986499 -45 ********** Masking position 4 Map Score: 3.89282 Number of sites scoring better than the average of aligned sites = 263 Number in coding regions = 247 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 3 GTGGATGATGAGGGCTCTGACTACACCGAT 1 102 1 AGGGCTCTGA 0.992602 -22 GGGAAATTAAGGGGCTCTGCATCATCCTCT 2 54 0 GGGGCTCTGC 0.997587 -193 ATTTTTAAGGGGGGCGCGGCACCTTTAATA 2 181 1 GGGGCGCGGC 0.975878 -66 ********** Masking position 5 Map Score: 3.11222 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 14 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 ACAGGCCGATGGAATGATCCCAGCTGTCCAGCT 1 34 0 GGAAGATCCG 0.988024 -90 TCATTCCATCGGCCTGTTCCCTGTCAGCAAGTA 1 50 1 GGCCGTTCCG 0.996384 -74 GTACCAGTTTGAACGTTTCCTTGTGGATGATGA 1 80 1 GAACTTTCCG 0.990871 -44 CCCTCTATACGAACAGTTCCACGATATGAATGC 2 81 1 GAACGTTCCG 0.998238 -166 CCACCCATATTAAAGGTGCCGCGCCCCCCTTAA 2 185 0 TAAAGTGCCG 0.955958 -62 **** ***** * Masking position 9 Map Score: 1.80477 Number of sites scoring better than the average of aligned sites = 149 Number in coding regions = 143 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 5 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.65857e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0