AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i177_cobalamin_biosynthesis_2_mthe_reg_100.orf -o177_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01626 132 M.thermo Motif number 1 GGCCGACAGAAGATGATGGAGTTTAGAGAC 1 15 0 AGATGATGGA 0.997852 -118 TATCTTACGGGGCTGATGCATTCCATCAGC 1 51 1 GGCTGATGCA 0.997538 -82 AAATGACCGGAGCTGATGGAATGCATCAGC 1 62 0 AGCTGATGGA 0.998596 -71 GTATGATGGTCAGCGCTCAA 1 123 0 GTATGATGGT 0.986227 -10 ********** Masking position 6 Map Score: 7.93426 Number of sites scoring better than the average of aligned sites = 192 Number in coding regions = 179 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 TCATCTTCTGTCGGCCGCAGGGTATCTTAC 1 29 1 TCGGCCGCAG 0.992766 -104 CAGGGTATCTTACGGGGCTGATGCATTCCA 1 46 1 TACGGGGCTG 0.994712 -87 GAGAAAAATGACCGGAGCTGATGGAATGCA 1 67 0 ACCGGAGCTG 0.992846 -66 TTTAAATAAATTGAGCGCTGACCATCATAC 1 113 1 TTGAGCGCTG 0.987229 -20 ********** Masking position 7 Map Score: 1.8176 Number of sites scoring better than the average of aligned sites = 227 Number in coding regions = 207 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 3 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0