AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i183_thiamin_biosynthesis_mthe_reg_100.orf -o183_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH02079 84 M.thermo #2 RTH01298 50 M.thermo Motif number 1 TACTCCTACTTAAAATATACTCCATTAGAG 1 18 0 TAAAATATAC 0.981223 -67 GTAGGAGTAATAAAATAATTTTTGATTAGT 1 39 1 TAAAATAATT 0.987841 -46 ATCTCCAGGGAAAAATATATTT 1 73 1 AAAAATATAT 0.960216 -12 TGAGTAAAATAATTCCGGGTCACG 2 5 1 TAAAATAATT 0.987841 -46 ********** Masking position 5 Map Score: 5.54383 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 15 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 2 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0