AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i198_enolase_mthe_reg_100.orf -o198_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01062 171 M.thermo #2 RTH01098 51 M.thermo Motif number 1 GGGACCGTAGGGTAGCTTGGT 1 2 1 GGACCGTAGG 0.991384 -170 CTTTTCAACTGGAACGGGGATGGTCAGCAC 1 64 1 GGAACGGGGA 0.994716 -108 GGTCAGCACCGGAACGCTGGAGACCCGAGT 1 85 1 GGAACGCTGG 0.997617 -87 CGCCGAGATTTGAACTCGGGTCTCCAGCGT 1 98 0 TGAACTCGGG 0.977055 -74 CGATTTGATGGGACCGCCGAGATTTGAACT 1 112 0 GGACCGCCGA 0.996685 -60 ********** Masking position 3 Map Score: 6.73756 Number of sites scoring better than the average of aligned sites = 125 Number in coding regions = 113 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 GGGACCGTAGGGTAGCTTGGTCCATCCTCC 1 10 1 GGTAGCTTGG 0.986917 -162 TCTTGGATTCGATTTGATGGGACCGCCGAGA 1 120 0 GTTTGATGGG 0.960042 -52 CATTAAAATAGAGGTTCTTGGATTCGATTTG 1 135 0 GGGTTCTTGG 0.99264 -37 CTATTTTAATGTTTTTCTTGGAGGCAT 1 155 1 GTTTTCTTGG 0.99204 -17 TGAAAAATAGTGGTTTATTAGAGT 2 4 0 TGTTTATTAG 0.924595 -48 TTTCAGTCTAGAGTTTATTATGAGGTGTTTT 2 30 1 GGTTTATTAT 0.924595 -22 * ********* Masking position 8 Map Score: 2.75168 Number of sites scoring better than the average of aligned sites = 365 Number in coding regions = 337 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 3 CGAATCCAAGAACCTCTATTTTAATGTTTT 1 140 1 AACCTCTATT 0.994697 -32 ACTCTAATAAACCACTATTTTTCAGTCTA 2 10 1 AACCACTATT 0.990737 -42 ACCTCATAATAAACTCTAGACTGAAAAATA 2 26 0 AAACTCTAGA 0.970765 -26 ********** Masking position 8 Map Score: 1.08151 Number of sites scoring better than the average of aligned sites = 19 Number in coding regions = 16 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 GGGTAGCTTGGTCCATCCTCCCAGCCATTG 1 20 1 GTCCATCCTC 0.992146 -152 TTCCGGTGCTGACCATCCCCGTTCCAGTTG 1 69 0 GACCATCCCC 0.992933 -103 ********** Masking position 5 Map Score: 0.589466 Number of sites scoring better than the average of aligned sites = 20 Number in coding regions = 18 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 ********** No masking Map Score: -1.68098e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.68098e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.68098e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0