AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i210_trans4_mthe_reg_100.orf -o210_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00189 109 M.thermo #2 RTH01001 16 M.thermo #3 RTH01019 18 M.thermo #4 RTH00961 18 M.thermo #5 RTH01648 30 M.thermo Motif number 1 AATATGCCCCTTCCAGTCCTCC 1 1 0 TTCCAGTCCC 0.996141 -109 GGGGCATATTTTCCAGTCCAGCGAAAAAACTT 1 23 1 TTCCAGTCGC 0.994389 -87 CCCGAAAAATTTCAGGTATCCCCTTAAAAAGT 1 51 0 TTCAGGTTCC 0.996799 -59 CCTGAAATTTTTCGGGTTTATCAGCAAATGCT 1 67 1 TTCGGGTTTC 0.985046 -43 CCTCCTTGTATTCAGCATTTGCTGATAAACCC 1 80 0 TTCAGCATGC 0.964991 -30 TTTATTTTCCTCTTTACC 3 1 0 TTCCTCTTCC 0.989281 -18 ******* * ** Masking position 2 Map Score: 6.33254 Number of sites scoring better than the average of aligned sites = 279 Number in coding regions = 255 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 2 CCTTAAAAAGTTTTTTCGCTGGACTGGAAAATA 1 29 0 TTTTCGCGGA 0.978441 -81 GCGAAAAAACTTTTTAAGGGGATACCTGAAATT 1 43 1 TTTTAGGGAT 0.995278 -67 ATTTTTCGGGTTTATCAGCAAATGCTGAATACA 1 73 1 TTTTAGCAAT 0.982973 -37 TCCTTGTCAGCTGGTT 2 2 0 CTTTAGCGGT 0.993347 -15 ATACTAAAAGTTACTGAGGTGATTTA 5 15 1 TTATAGGGAT 0.984633 -16 *** * *** *** Masking position 5 Map Score: 2.48377 Number of sites scoring better than the average of aligned sites = 100 Number in coding regions = 78 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 TATGCCCCTTCCAGTCCTCC 1 1 0 CCAGTCCTCC 0.992687 -109 GGCATATTTTCCAGTCCAGCGAAAAAACTT 1 25 1 CCAGTCCAGC 0.989425 -85 ********** Masking position 5 Map Score: 1.29248 Number of sites scoring better than the average of aligned sites = 24 Number in coding regions = 21 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 CTGGACTGGAAAATATGCCCCTTCCAGTCC 1 14 0 AAATATGCCC 0.976177 -96 GAAAAATTTCAGGTATCCCCTTAAAAAGTT 1 50 0 AGGTATCCCC 0.986274 -60 CAGCATTTGCTGATAAACCCGAAAAATTTC 1 70 0 TGATAAACCC 0.92863 -40 TCAAGAAACCTCCTTGTATTCA 1 98 0 AAGAAACCTC 0.95832 -12 TAAATCACCTCAGTAACTTTT 5 20 0 AAATCACCTC 0.969325 -11 ********** Masking position 8 Map Score: 1.4486 Number of sites scoring better than the average of aligned sites = 617 Number in coding regions = 570 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 5 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0