AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i250_fts_cell_wall_mthe_reg_300.orf -o250_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01854 151 M.thermo #2 RTH01592 235 M.thermo Motif number 1 TCTGTTTGAGTCAGAAATAACGGGATCCAT 1 21 1 TCAGAAATAA 0.957898 -131 AACATATGAATCCTAATTAATATGGATCCC 1 42 0 TCCTAATTAA 0.79149 -110 CCTATACCTGCCATAAATATATCCAAATAT 1 94 1 CCATAAATAT 0.959069 -58 ATAAATATATCCAAATATAATTTGAGATCA 1 106 1 CCAAATATAA 0.908374 -46 TAATTTGAGATCAGGTATATATAAGTAGGT 1 123 1 TCAGGTATAT 0.725485 -29 GTCCACGTGGCCATGAATATCATGAATCTG 2 46 0 CCATGAATAT 0.919709 -190 GCCACGTGGACCATCAATAATTTTATTTTG 2 65 1 CCATCAATAA 0.932174 -171 TGGCTCACATTCAAAATTAAAAATCAATTT 2 130 0 TCAAAATTAA 0.86944 -106 TTGTGATAAGACATATTTAAAAGCAACGGT 2 182 0 ACATATTTAA 0.700621 -54 ATAACATATTTCATAGATAAGTGTGGGGGT 2 211 1 TCATAGATAA 0.922315 -25 ********** Masking position 8 Map Score: 5.79207 Number of sites scoring better than the average of aligned sites = 303 Number in coding regions = 219 Number in noncoding regions = 84 Number of orfs with sites within 600 bp upstream = 93 Fraction of orfs with sites within 600 bp upstream = 0.0149374 Motif number 2 GACTCAAACAGAAGGTGATGTT 1 3 0 GAAGGTGATG 0.969771 -149 GTATATATAAGTAGGTGGTGTTTTC 1 137 1 GTAGGTGGTG 0.959054 -15 TGAATATCATGAATCTGGGCGGGACCCCCC 2 33 0 GAATCTGGGC 0.96367 -203 ATACCGGCTCAAGGTTGGGGCAAAATAAAA 2 85 0 AAGGTTGGGG 0.937822 -151 TTTTAATTTTGAATGTGAGCCATGGCTCCA 2 138 1 GAATGTGAGC 0.969286 -98 TTTCATAGATAAGTGTGGGGGTAGTAA 2 219 1 AAGTGTGGGG 0.980414 -17 ********** Masking position 6 Map Score: 2.01969 Number of sites scoring better than the average of aligned sites = 889 Number in coding regions = 819 Number in noncoding regions = 70 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 3 ATCCTAATTAATATGGATCCCGTTATTTCT 1 33 0 ATATGGATCC 0.9931 -119 GGTAGTAAACATATGAATCCTAATTAATAT 1 49 0 ATATGAATCC 0.973156 -103 TGAATGTGAGCCATGGCTCCATCGGTGCCA 2 147 1 CCATGGCTCC 0.987126 -89 GCAACGGTTAATCTGGCACCGATGGAGCCA 2 160 0 ATCTGGCACC 0.981038 -76 ********** Masking position 4 Map Score: 1.61593 Number of sites scoring better than the average of aligned sites = 117 Number in coding regions = 106 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 4 ATGGCAGGTATAGGAAAAATTTTTATAAAG 1 78 0 TAGGAAAAAT 0.976449 -74 CAAATTATATTTGGATATATTTATGGCAGG 1 100 0 TTGGATATAT 0.877248 -52 CATGACATGTTATGAAAAAG 2 1 0 TATGAAAAAG 0.923518 -235 GTTATTGTGATAAGACATATTTAAAAGCAA 2 186 0 TAAGACATAT 0.927413 -50 CACACTTATCTATGAAATATGTTATTGTGA 2 206 0 TATGAAATAT 0.974625 -30 ********** Masking position 5 Map Score: 0.586227 Number of sites scoring better than the average of aligned sites = 45 Number in coding regions = 29 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0